Amicon ultra column
Amicon Ultra columns are centrifugal filter devices used for rapid concentration and desalting of protein samples. They feature a regenerated cellulose membrane with a specified molecular weight cutoff, allowing for the selective retention of macromolecules while permitting the passage of smaller molecules.
Lab products found in correlation
21 protocols using amicon ultra column
Glycoprofiling of Cell Secretome
BPIFB4 Expression and Secretion in HEK293T Cells
Plasma Exosome Isolation and Characterization
Generating UZGENT_A3 and UZGENT_G5 Mutants
Primer name | Polarity | Primer sequence |
---|---|---|
UZGENT_A3 HC-N59Q | Sense | GATCAACCCTAACAGTGGCGGAACACAGTACACACAGAAGTTTAAG |
UZGENT_A3 HC-N59Q | Antisense | CTTAAACTTCTGTGTGTACTGTGTTCCGCCACTGTTAGGGTTGATC |
UZGENT_G5 HC-N59Q | Sense | CTATCAGTGGTGCCACACAGTATACACAGAAGTTTCAGGG |
UZGENT_G5 HC-N59Q | Antisense | CCCTGAAACTTCTGTGTATACTGTGTGGCACCACTGATAG |
Purification of Mycobacterium tuberculosis Alanine Racemase
The TESEC Alr Purification strain was grown to saturation in 500 mL of LB supplemented with ampicillin, kanamycin, D-alanine, and 100 mM L-arabinose. A cell pellet of approximately 2 grams was harvested by centrifugation, cooled to 4 °C and lysed with 10 mL B-PER reagent (ThermoFisher 78248) and a standard EDTA-free protease inhibitor cocktail (Merck 11873580001).
The lysate was cleared by centrifugation and passed over 3 mL HisPur spin columns (ThermoFisher 88226). Elution fractions were collected with increasing concentrations of imidazole (Sigma I2399) and checked for the presence of a single band using SDS-PAGE gels (Bio-Rad 4561081) and Coomassie staining. Successful elutions were combined and dialyzed (ThermoFisher 66380) against 20 mM Tris, 100 mM NaCl pH 8.0 for 72 h at 4 °C. Finally, samples were concentrated by centrifugal filtration in Amicon Ultra columns (Merck UFC9010). Total protein concentrations were determined using the Rapid Gold BCA Protein Assay (ThermoFisher A53226) calibrated to a standard curve following the manufacturer’s protocol.
Protein Extraction and Western Blotting Protocol
Lentiviral Knockdown of REEP Proteins
Gelatin Zymography Analysis of Matrix Metalloproteinases
Gelatin Zymography for Secreted Proteases
Reelin Protein Production and Purification
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!