Primers (fw: 5′ GTAAGAAAATCTTAACCTAGCAAATGGGT 3′; rv: 5′ CCAGGGAGTTTTTTGTTCTTTCA 3′) targeting SNP rs81416363 (g.118314929 A > G) on chromosome 9, generating a 75 bp long amplicon, were designed in-house. For the analysis of SNP g.299084751 C > T on chromosome 1, the real-time PCR primers (fw: 5′ CCTGGGAACAGGGCTTCA 3′; rv: 5′ AAGCTCACCTGGAGGACAGTGT 3′), generating a 67 bp long amplicon, were used. PCR and subsequent HRM analysis was carried out using a Rotor-Gene Q (Qiagen) thermocycler and the EpiTect HRM PCR Kit (Qiagen). PCR-HRM was carried out in a total volume of 20 µL. The reaction mixture consisted of 10 µL EpiTect HRM PCR Kit (Qiagen), 0.2 µM of each primer, 7.2 µL RNase-free water and 2 µL DNA extract (5 ng/µL). The PCR temperature program consisted of an initial denaturation at 95 °C for 5 min, followed by cycling (50 × (94 °C for 10 s; 60 °C for 20 s, 72 °C for 20 s)) and final elongation at 72 °C for 10 min. After denaturation at 95 °C for 1 min and hybridization at 40 °C for 1 min, HRM was performed by increasing the temperature from 65 °C to 95 °C in 0.1 °C increments per 2 s. Data was analysed using the Rotor-Gene Q Series Software 2.3.1 (Qiagen).
Epitect hrm pcr kit
Manufactured by Qiagen
Sourced in Germany
The EpiTect HRM PCR Kit is a real-time PCR assay designed for high-resolution melting (HRM) analysis. It enables the detection and quantification of DNA methylation patterns in gene promoter regions.
Automatically generated - may contain errors
Lab products found in correlation
Epitect bisulfite kit, by Qiagen (6 mentions)
Rotor gene q, by Qiagen (3 mentions)
Rotor gene q cycler, by Qiagen (2 mentions)
Qiaamp dna mini kit, by Qiagen (2 mentions)
Nanodrop one, by Thermo Fisher Scientific (2 mentions)
Methyl primer express v1, by Thermo Fisher Scientific (1 mentions)
Epitect control dna, by Qiagen (1 mentions)
Myiq device, by Bio-Rad (1 mentions)
Methyl primer express software v1, by Thermo Fisher Scientific (1 mentions)
Ariamx real time pcr system, by Agilent Technologies (1 mentions)
Rotor gene q series software 2, by Qiagen (1 mentions)
10 protocols using epitect hrm pcr kit
1
Genotyping of SNPs rs81416363 and g.299084751 Using Real-Time PCR-HRM
2
Methylation Analysis of CYP1B1 in Leukemia
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was modified by treatment with sodium bisulfite using the EpiTect Bisulfite Kit (Qiagen) as recommended.23 (link) The following primer sequences for methylation-insensitive amplification of a part of the CYP1B1 5′ region (ENSEMBL database, release 69) were designed using the Methyl Primer Express v1.0 software (Applied Biosystems, Carlsbad, CA, USA): fwd, 5′-GGTTAAAGYGGTTTGGTGT-3′ and rev, 5′-CTCCCACTCCAAAATCAAAA-3′. MS-HRM analyses were performed using the EpiTect HRM PCR Kit in a RotorGeneQ cycler (Qiagen).23 (link) Methylation standards were constructed by diluting 100% methylated and unmethylated control DNA (Qiagen) at 100, 75, 50, 25, 10 and 0% ratios. Melting curves were normalized by calculation of two normalization regions before and after the major fluorescence decrease using the RotorGeneQ software. Normalized fluorescence values were plotted against the percentage of methylation for each of the methylation standards to generate a standard curve for the calculation of methylation levels of genes in leukemia cells. Water blanks were used as negative controls.
3
Validating DNA Methylation Analysis Methods
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To validate the results of the Infinium and sodium bisulfite sequencing methods, the DNA methylation status of the NR5A1, STAR, STRA6 and HSD17B2 genes was examined by MS-HRMA [18] (link), [19] (link) using a larger number of samples of isolated euESCa (n = 7) and choESC (n = 6). MS-HRMA was carried out on a Roter-Gene 6000 thermocycler (Corbett Research, Mortlake, Australia). Briefly, 10 ng of bisulfite-modified DNA template was prepared in a 25 µl PCR mix using an EpiTect HRM PCR kit (QIAGEN). The primer sets were the same as those used for bisulfite sequencing and MS-HRMA except for those for HSD17B2. For HSD17B2, the following primers were used: HSD17B2 (forward, 5′- AGGTGTGTGTTTGTGGGTGAGTA-3′ , reverse, 5′- TTCAACATAAATACCAAAACACTTCC-3′ ) (101 bp). PCR was performed in 40 cycles as follows: pre-incubation for 5 min at 95°C, denaturation for 10 sec at 95°C, annealing for 30 sec at 55°C and extension for 10–26 sec (primer-dependent) at 72°C. The methylation-sensitive high resolution melting was run in the interval of 72°C to 95°C with 2 sec, 0.1°C steps, acquiring fluorescence data at the Roter-Gene HRM channel. All reactions were run in duplicate.
4
Methylation-sensitive High-Resolution Melting Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Methylation-sensitive high-resolution melting assay (MS-HRM) was performed on the 45 paired lung cancer and normal lung tissues to validate the methylation status of the candidate genes identified by the integrated analysis. A range of standards was included to control for bias in the sensitivity of the detection: 0% (unmethylated: EpiTect Control DNA; Qiagen), 100% (methylated: EpiTect Control DNA), and 50% (equal mixture of both templates). MS-HRM primers were designed to amplify a short amplicon size of less than 200 bp (http://www.urogene.org/cgi-bin/methprimer ) and synthesized by Sangon Biotech (Shanghai, China) (S2 Table ). MS-HRM assay was performed according to the instructions for the Epitect HRM PCR kit (Qiagen) on the RotorGene Q (Qiagen) in triplicate. A sample amplification curve between the 50% and 100% standard curves was defined as hypermethylation, and a sample amplification curve between the 0% and 50% standard curves was defined as hypomethylation.
5
HPV Genotyping and DNA Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The HPV genotype test used the 21 HPV GenoArray Diagnostic Kit from ChaoZhou Hybribio Biological Chemical Co. Ltd. (People's Republic of China). The method of HPV genotype test was flow-through hybridization and gene chip, the equipments for the test such as Thermal Cycler and HybriMax devices (Flow-through Hybridization HybriMax).
The DNA ploidy analysis kit was from the Beckman Coulter; the flow cytometer was Beckman CytomicsTM FC500. The DNA cell cycle analysis software was also from Beckman Coulter.
The L1 gene methylation level was tested by the methylation-sensitive high resolution melting (MS-HRM). The major instrument was Roche LightCycler type 480 sensitivity analyzer. The completely methylated and unmethylated HPV-16 L1 gene standards of MS-HRM were synthesized (Genscript, Nanjing, China), the specific primers also were synthesized (Genscript, Nanjing, China). The EpiTect Bisulfite Kit and EpiTect HRM PCR Kit were bought from Germany QIAGEN company.
The DNA ploidy analysis kit was from the Beckman Coulter; the flow cytometer was Beckman CytomicsTM FC500. The DNA cell cycle analysis software was also from Beckman Coulter.
The L1 gene methylation level was tested by the methylation-sensitive high resolution melting (MS-HRM). The major instrument was Roche LightCycler type 480 sensitivity analyzer. The completely methylated and unmethylated HPV-16 L1 gene standards of MS-HRM were synthesized (Genscript, Nanjing, China), the specific primers also were synthesized (Genscript, Nanjing, China). The EpiTect Bisulfite Kit and EpiTect HRM PCR Kit were bought from Germany QIAGEN company.
6
HPV Genotyping and L1 Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The HPV genetype test used the 21 HPV GenoArray Diagnostic Kit from ChaoZhou Hybribio Biological Chemical Co. Ltd., People's Republic of China. The method of HPV genetype test was flow-through hybridization and gene chip (FHGC), the equipments for the test such as Thermal Cycler and HybriMax devices (Flow-through Hybridization HybriMax).
The L1 gene methylation levels were tested by the methylation-sensitive high resolution melting (MS-HRM). The major instrument was Roche LightCycler type 480 sensitivity analyzer. The completely methylated and unmethylated HPV-16 L1 gene standards of MS-HRM were synthesized (Genscript, Nanjing,China); the specific primers also were synthesized (Genscript, Nanjing,China). The EpiTect Bisulfite Kit and EpiTect HRM PCR Kit were bought from Germany QIAGEN company.
The PD-L1 flow cytometry analysis kit (BB515 Mouse Anti-Human CD274, Lot: 564554) and Isotype control reagent kit (BB515 Mouse BALB/c IgG1-κ, Lot: 564416) were from the BD BIOSCIENCES PHARMINGEN (USA); the flow cytometer was Beckman CytomicsTM FC500 (USA).
The L1 gene methylation levels were tested by the methylation-sensitive high resolution melting (MS-HRM). The major instrument was Roche LightCycler type 480 sensitivity analyzer. The completely methylated and unmethylated HPV-16 L1 gene standards of MS-HRM were synthesized (Genscript, Nanjing,China); the specific primers also were synthesized (Genscript, Nanjing,China). The EpiTect Bisulfite Kit and EpiTect HRM PCR Kit were bought from Germany QIAGEN company.
The PD-L1 flow cytometry analysis kit (BB515 Mouse Anti-Human CD274, Lot: 564554) and Isotype control reagent kit (BB515 Mouse BALB/c IgG1-κ, Lot: 564416) were from the BD BIOSCIENCES PHARMINGEN (USA); the flow cytometer was Beckman CytomicsTM FC500 (USA).
7
Profiling CDK6 Chromatin Binding
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
ChIP experiments were performed in accordance to previously described protocols using anti-CDK6 rabbit polyclonal Antibody (Santa Cruz, H96) [4 (link)] [6 (link)]. For analysis of CDK6-bound regions, co-immunoprecipitated DNA was analyzed by qPCR (EpiTect HRM PCR Kit, Qiagen) for VEGF-A promoter binding using a MyiQ device (Bio-Rad). Background was evaluated via a negative control region (Human Negative Control Primer Set 1, Active Motif). Primer sequences are available upon request.
8
Bisulfite Conversion and HRM PCR for DNA Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from fibroblasts using the QIAamp DNA Mini Kit (Qiagen) according to the manufacturer’s instructions. To assess methylation of a specific DNA region, DNA was converted with bisulfite treatment, using the EpiTect Bisulfite Kit (Qiagen) according to the manufacturer’s instructions. Then, HRM PCR was performed using the EpiTect HRM PCR kit (Qiagen) to amplify the specific DNA region and to measure the melting temperature of the amplicon on an AriaMx Realtime PCR system (Agilent Genomics). One hundred percent methylated DNA, 100% unmethylated DNA, and bisulfite unconverted DNA from the EpiTect Control DNA Set kit (Qiagen) were used as controls. Figures with methylation peaks were produced with Agilent Aria 1.5 Software (Agilent Genomics). Primers were designed with Methyl Primer Express Software v1.0 (ThermoFisher Scientific) and were provided by Eurogentec. The following primers were used for methylation study:
9
Quantification of ZNF677 DNA Methylation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from NHBECs, tumor cell lines and frozen tissue samples as reported and was stored at −80°C until use for methylation analyses [8 (link)]. Afterwards, genomic DNA was modified by treatment with sodium bisulfite using EpiTect Bisulfite kit (Qiagen) [37 (link)]. Primers (fwd, 5′-GTTTTTYGGGTTTAAGTTTG-3′ and rev, 5′-AATTTTAACCTACAAAACRACC-3′) were designed based on the genomic ZNF677 sequence obtained from ENSEMBL database (release 69) using Methyl Primer Express v1.0 software. EpiTect HRM PCR kit in a RotorGene®Q cycler (Qiagen) was used. Methylation standards were constructed by diluting 100% methylated and unmethylated control DNA (Qiagen) at 100%, 75%, 50%, 25%, 10% and 0% ratios [37 (link)]. The standards were included in each HRM run performed. All experiments were performed in duplicate.
10
LINE-1 Promoter Methylation Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Global DNA was extracted from the cells using the QIAamp DNA Mini Kit (Qiagen) according to the manufacturer’s protocol for cell culture. DNA samples were stored at −20°C before the bisulfite conversion was performed. To convert unmethylated cytosines to uracil and thus to distinguish between the latter and unaltered 5-methylcytosines, bisulfite treatment was carried out using the Qiagen EpiTect Bisulfite Kit (Qiagen) as explained in the manufacturer’s instructions. DNA concentrations were determined with a Nanodrop One (Thermo Fisher Scientific) spectrophotometer. LINE-1 promoter methylation was assessed by methylation-sensitive high-resolution melting (HRM) curve analysis. Each reaction was performed in technical duplicates using the EpiTect HRM PCR Kit (Qiagen) according to the EpiTect® HRMTM PCR handbook. Methylation standards of 0% and 100% were mixed to obtain 0, 25, 50, 75, and 100% methylated samples and were included in the assay. PCR amplification and HRM analysis were performed with a Rotor-Gene® Q (Qiagen) containing a 72-well rotor. The data were analyzed with Rotor-Gene® Series Software Version 2.3.1 that produced normalized melting curves. After exporting relative fluorescence units to GraphPad Prism (Version 6), the area under the curve was calculated and linear regression was applied to interpolate each sample value from the data of the standard curve.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!