Amplitaq gold dna polymerase

Manufactured by PerkinElmer

Sourced in United States, France

AmpliTaq Gold DNA polymerase is a thermostable DNA polymerase enzyme used in the polymerase chain reaction (PCR) process to amplify DNA sequences. It exhibits 5'-3' polymerase activity and 5'-3' exonuclease activity.

Automatically generated - may contain errors

Lab products found in correlation

9700 thermocycler, by PerkinElmer (2 mentions) Allprep dna rna mini kit, by Qiagen (1 mentions) Gel doc, by Bio-Rad (1 mentions) Anti stat3 sc 482, by Santa Cruz Biotechnology (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Random hexamer primer, by Thermo Fisher Scientific (1 mentions) Superscript 3 rt, by Thermo Fisher Scientific (1 mentions) Fuji rx film, by Fujifilm (1 mentions) Amplitaq gold dna polymerase, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

AmpliTaq Gold (22 citations) AmpliTaq Gold polymerase (13 citations) AmpliTaq DNA polymerase (5 citations) AmpliTaq polymerase (2 citations)

9 protocols using amplitaq gold dna polymerase

TCR β Chain Spectratyping Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 2

Virtual TCR β chain spectratyping was performed as follows. Complementary DNA was synthesized from RNA extracted from sorted T cell populations and used as template for multiplex PCR amplification of the rearranged TCR β chain CDR3 region. Each multiplex reaction contained a 6-FAM-labeled antisense primer specific for the TCR β chain constant region, and two to five TCR β chain variable (TRBV) gene-specific sense primers. All 23 functional Vβ families were studied. PCR reactions were carried out on a Hybaid PCR Express thermal cycler (Hybaid, Ashford, UK) under the following cycling conditions: 1 cycle at 95° C. for 6 minutes, 40 cycles at 94° C. for 30 seconds, 58° C. for 30 seconds, and 72° C. for 40 seconds, followed by 1 cycle at 72° C. for 10 minutes. Each reaction contained cDNA template, 500 μM dNTPs, 2 mM MgCl₂and 1 unit of AmpliTaq Gold DNA polymerase (Perkin Elmer) in AmpliTaq Gold buffer, in a final volume of 20 μl. After completion, an aliquot of the PCR product was diluted 1:50 and analyzed using a DNA analyzer. The output of the DNA analyzer was converted to a distribution of fluorescence intensity vs. length by comparison with the fluorescence intensity trace of a reference sample containing known size standards.

US11214793B2. Method of measuring adaptive immunity (2022-01-04). FRED HUTCHINSON CANCER RESEARCH CENTER [US]. Inventors: Harlan S. Robins [US], Edus H. Warren, III [US], Christopher Scott Carlson [US].

+ Open protocol

+ Expand

DNA Extraction and cDNA Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted from cells using an AllPrep DNA/RNA Mini Kit (QIAGEN, Dusseldorf,
Germany). Polymerization reactions were performed in a Perkin-Elmer 9700 Thermocycler with
3 μL of cDNA (20 ng DNA equivalents), 160 μmol/L cold Deoxy nucleotide triphosphates
(dNTPs), 10 pmol appropriate oligonucleotide primers, 1.5 mmol/L MgCl₂, and 5
units AmpliTaq Gold DNA polymerase (Perkin-Elmer, Norwalk, CT, USA) in 1× polymerase chain
reaction (PCR) buffer. The oligonucleotide primers were described previously^{19 (link)}. (Fig. 1B). The thermal
cycle profile included a 10-min denaturing step at 94 °C, followed by amplification cycles
(denaturation for 1 min at 94 °C, annealing for 1 min at 57 °C to 62 °C, and extension for
1 min at 72 °C) with a final extension step of 10 min at 72 °C.

Miyagi-Shiohira C., Nakashima Y., Kobayashi N., Saitoh I., Watanabe M., Noguchi Y., Kinjo T, & Noguchi H. (2018). The Development of Cancer through the Transient Overexpression of Reprogramming Factors. Cell Medicine, 10, 2155179017733172.

+ Open protocol

+ Expand

Methylation-Specific PCR for DNA Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The PCR primers used were methF1 (5′–GGAAGTTGATGAGGTATGTATAGTATAA–3′) and methR1biot (5′–AATACCATTTCCAAAAAAAATAAAATCCA–3′). PCR was performed on a MyCycler apparatus using the following conditions: 50 µL of final volume containing 1 µL of DNA solution (approximately 100–150 ng/ µL), a 16-nM concentration of each deoxynucleoside triphosphate, a 0.5-mM concentration of each primer, 1.5 mM MgCl₂, and 2 U of AmpliTaq Gold DNA polymerase (Perkin-Elmer, Roissy, France) in the buffer supplied by the manufacturer. The amplification conditions were as follows: 10 min at 94 °C, followed by 40 cycles of 30 s at 94 °C, 30 s at 49 °C, and 30 s at 72 °C, before being held for 7 min at 72 °C. All fragments were subjected to gel electrophoresis on 2% agarose gels containing ethidium bromide, before isolation for pyrosequencing.

Mahmoudi R., Feldman S., Kisserli A., Duret V., Tabary T., Bertholon L.A., Badr S., Nonnonhou V., Cesar A., Neuraz A., Novella J.L, & Cohen J.H. (2018). Inherited and Acquired Decrease in Complement Receptor 1 (CR1) Density on Red Blood Cells Associated with High Levels of Soluble CR1 in Alzheimer’s Disease. International Journal of Molecular Sciences, 19(8), 2175.

+ Open protocol

+ Expand

ChIP-seq protocol for STAT3 binding analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Chromatin immunoprecipitation (ChIP) was carried out with Imunoprecipitation Assay Kit (Upstate Biotechnology) according to the manufacturer's instruction. Approximately 10⁷ cells were fixed in 1% formaldehyde and 125 mM glycine. Cells were lysed and chromatin sonication was performed with a Bioruptor Diagenode model UCD300 to obtain an average fragment length of ~400 bp. Samples were precleared with protein A-G Sepharose and incubated overnight at 4°C with 2 μg of antibody anti-IgG or anti-STAT3, sc-482 (Santa Cruz Biotechnology). Input and immunoprecipitated DNAs were analyzed by PCR performed with AmpliTaq Gold DNA polymerase (Perkin-Elmer, MA, USA), resolved on 2% agarose gel and scanned using GelDoc (BioRad, Hercules, CA). Primers used were 5′-GCCGCTGTTTACAAGGACAC-3′ (forward) and 5′-CTAGTCAGCCACGGAAGTGC-3′ (reverse).

Malanga D., De Marco C., Guerriero I., Colelli F., Rinaldo N., Scrima M., Mirante T., De Vitis C., Zoppoli P., Ceccarelli M., Riccardi M., Ravo M., Weisz A., Federico A., Franco R., Rocco G., Mancini R., Rizzuto A., Gulletta E., Ciliberto G, & Viglietto G. (2015). The Akt1/IL-6/STAT3 pathway regulates growth of lung tumor initiating cells. Oncotarget, 6(40), 42667-42686.

+ Open protocol

+ Expand

RNA Extraction and Reverse Transcription

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells using the RNeasy Mini Kit (Qiagen, Tokyo, Japan). After the RNA was quantified using spectrophotometry, 2.5 μg of the RNA was heated at 85°C for 3 min and then reverse-transcribed into cDNA in a 25-μL reaction containing 200 units of Superscript III RT (Life Technologies), 50 ng of random hexamer primers (Life Technologies), 160 μmol/L dNTP, and 10 nmol/L dithiothreitol. The reaction consisted of 10 min at 25°C, 60 min at 42°C, and 10 min at 95°C. PCRs were performed in a Perkin-Elmer 9700 Thermocycler with 3 μL of cDNA (20 ng RNA equivalent), 160 μmol/L cold dNTPs, 10 pmol of the appropriate oligonucleotide primers, 1.5 mmol/L MgCl₂, and 5 units of AmpliTaq Gold DNA polymerase (Perkin-Elmer, Waltham, MA, USA). The oligonucleotide primers and cycle numbers used for semi-quantitative PCR are shown in Table
1. The thermal cycle profile used a 10-min denaturing step at 94 C followed by the amplification cycles (1 min denaturation at 94 C, 1 min annealing at 57 C, and 1 min extension at 72°C), with a final extension step of 10 min at 72°C. The steps taken to validate these measurements were previously reported
[19 (link)].

Kuise T., Noguchi H., Tazawa H., Kawai T., Iwamuro M., Saitoh I., Usui Kataoka H., Watanabe M., Noguchi Y, & Fujiwara T. (2014). Establishment of a pancreatic stem cell line from fibroblast-derived induced pluripotent stem cells. BioMedical Engineering OnLine, 13, 64.

+ Open protocol

+ Expand

Detecting K-ras Mutations by PCR-SSCP

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA samples were screened for mutations of K-ras by PCR-single-strand conformation polymorphism (SSCP) analysis. The PCR primers were designed to amplify mutation hot spots, codons 12 and 13, of the K-ras [8 (link)]. PCR-SSCP analysis was performed as described previously [8 (link)]. Briefly, each 25-_μL reaction mixture contained 1 × AmpliTaq Gold Buffer (8.0 mmol/L Tris–HCl, pH 8.3; 40 mmol/L KCl; Perkin-Elmer, Branchburg, NJ, USA), 4 mmol/L MgCl₂, 0.3 mmol/L of each deoxynucleotide triphosphate, 100 pmol of each primer, 10–20 ng genomic DNA, 2.5 mCi [_α³²-P]dCTP (3000 Ci/mmol/L, 10 mCi/mL), and 1.25 U AmpliTaq Gold DNA polymerase (Perkin-Elmer). The reaction mixtures were heated to 95°C for 10 min, followed by 45 cycles of denaturation at 94°C for 1 min, annealing at 55°C for 2 min, and strand elongation at 72°C for 2 min. After PCR, the samples were electrophoresed on 6% polyacrylamide gels (ratio of acrylamide:bis-acrylamide, 19:1) with 10% glycerol at 4°C. The gels were then subjected to autoradiography overnight at −80°C on Fuji RX film (Fuji Film, Minamiashigara, Japan).

Miwata T., Hiyama T., Quach D.T., Le H.M., Hua H.N., Oka S., Tanaka S., Arihiro K, & Chayama K. (2014). Differences in K-ras and mitochondrial DNA mutations and microsatellite instability between colorectal cancers of Vietnamese and Japanese patients. BMC Gastroenterology, 14, 203.

+ Open protocol

+ Expand

Phylogenetic Identification of Bacterial Isolates

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA samples obtained from the cell biomass of isolates cultivated in 1/10 PYG at 10°C were used as templates for PCR amplification. The 16S rRNA gene sequences of the isolates were PCR-amplified using the 27f/1492r primer pair using AmpliTaq Gold DNA polymerase (Perkin-Elmer) and sequences were elucidated as previously described (Satoh et al., 2002 ). The sequences of the nearly complete 16S rRNA genes of the isolates were submitted to the DDBJ/EMBL/GenBank database to search for similar sequences using the BLAST program (Altschul et al., 1997 (link)). The sequences of 16S rRNA genes from closely related species were edited using SeaView software (Gouy et al., 2010 (link)) and multiple alignments were performed with the CLUSTAL W program (Larkin et al., 2007 (link)). A phylogenetic tree was constructed from the evolutionary distance matrix by the neighbor-joining method with MEGA11 software (https://megasoftware.net/) (Saitou and Nei, 1987 (link); Tamura et al., 2021 (link)).

Honma S., Ueki A., Ichimura A., Suzuki K., Kaku N, & Ueki K. (2023). Phylogeny and Physiological Diversity of Cold-adapted Anaerobic Bacteria Isolated from Rice Field Soil in Japan. Microbes and Environments, 38(2), ME22109.

+ Open protocol

+ Expand

SCAR-PCR Assays for Fungal Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

SCAR-PCR mixtures (25 µL volume) for Ma-151_OPA-04 marker assays consisted of 0.5 units of AmpliTaq Gold DNA Polymerase from Thermo Fisher Scientific Inc. (10 mM Tris–Cl, 50 mM KCl, pH 8.3, Waltham, MA, USA), 0.2 mM of each dNTP from Boehringer-Mannheim, 10 pmoles of each primer, 1.0 mM MgCl₂, and 10 ng fungal DNA. Amplification was carried out under the following conditions: 94 °C for 3 min; 25 amplification cycles (1 min denaturation at 94 °C, 1 min annealing at 62 °C, 2 min of extension at 72 °C); and a final 5-min extension at 72 °C. PCR mixtures (25 µL volume) for the Ma-160_OPA-05 marker assay consisted of 0.5 units of AmpliTaq Gold DNA Polymerase from Perkin-Elmer (10 mM Tris–HCl, 50 mM KCl, pH 8.3), 0.2 mM of each dNTP from Boehringer-Mannheim, 10 pmoles of each primer, 2.5 mM MgCl₂, and 10 ng fungal DNA. Amplification was carried out under the following conditions: 94 °C for 3 min; 25 amplification cycles (1 min denaturation at 94 °C, 1 min annealing at 55 °C, 2 min of extension at 72 °C); and a final 5-min extension at 72 °C. Amplified products were resolved by electrophoresis in 1.5% agarose gels (Figure 1).

Toriello C., Duarte-Escalante E., Frías-De-León M.G., Brunner-Mendoza C., Navarro-Barranco H, & Reyes-Montes M.D. (2024). Development of SCAR Markers for Genetic Authentication of Metarhizium acridum. Journal of Fungi, 10(4), 269.

+ Open protocol

+ Expand

Genotyping the NM_000173.6:c.368T>C Mutation

Check if the same lab product or an alternative is used in the 5 most similar protocols

The NM_000173.6:c.368T>C mutation was genotyped by PCR-SSP. Briefly, PCR was performed with 50 ng of DNA in 20 lL of a reaction mix containing 1 9 Taq buffer, 2 mM MgCl 2 , 200 mM each dNTP and 0.5 units of Ampli Taq Gold DNA polymerase (Perkin-Elmer, Courtaboeuf, France), 5% DMSO, 1.2 mM common forward primer 5 0 pggaggaccgcacgcccgagg-3 0 OH, and 1.2 mM reverse primer 5 0 p-gcctgtcagccggcccagcg-3 0 OH to amplify the Cab4a allele, or 5 0 p-gcctgtcagccggcccagca-3 0 OH to amplify the Cab4b allele. The reaction mix also contained 7 lM each of internal positive control primers CRP-I 5 0 p-ccagcctctctcatgcttttggccagacag-3 0 OH and CRP-II 5 0 p-gggtcgaggacagttccgtgtagaagtgga-3 0 OH. PCR was performed in a MasterCycler ep Gradiant S thermocycler (Eppendorf, Le Pecq, France). A single step of 95 °C for 2 min to denature genomic DNA was followed by 29 cycles of denaturation (95 °C, 20 s), annealing (70 °C, 20 s), and elongation (72 °C, 45 s). A final elongation step (72 °C, 7 min) ended the reaction. PCR products were analyzed under ultraviolet light in the presence of ethidium bromide after electrophoresis in a 2.5% agarose gel.

Jallu V., Beranger T., Bianchi F., Casale C., Chenet C., Ferre N., Philippe S., Quesne J., Martageix C, & Petermann R. (2017). Cab4b, the first human platelet antigen carried by glycoprotein IX discovered in a context of severe neonatal thrombocytopenia. Journal of thrombosis and haemostasis : JTH, 15(8).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!