Log In Sign up
The largest database of trusted experimental protocols

Sybr mixture

Manufactured by Takara Bio
Visit Supplier
Sourced in United States, Japan

SYBR mixture is a ready-to-use solution containing SYBR Green I dye, which is a fluorescent dye that binds to double-stranded DNA. The mixture is designed for real-time PCR applications, allowing the detection and quantification of target DNA sequences.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (8 mentions) M mlv reverse transcriptase, by Promega (6 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Primescript rt kit, by Takara Bio (1 mentions) Trizol reagent, by Beyotime (1 mentions) Mirna first strand cdna kit, by Tiangen Biotech (1 mentions) Abi prism 7000 sequence detection system, by Thermo Fisher Scientific (1 mentions) Brilliant sybr green qpcr master mix, by Takara Bio (1 mentions) Pg lps, by Merck Group (1 mentions) Rt master mix, by Takara Bio (1 mentions) Il 1β, by GeneCopoeia (1 mentions) Tnf α, by GeneCopoeia (1 mentions) Gapdh, by GeneCopoeia (1 mentions) Real time pcr primer col 1, by GeneCopoeia (1 mentions) Runx 2, by GeneCopoeia (1 mentions) Il 18, by GeneCopoeia (1 mentions) Beta actin antibody, by Proteintech (1 mentions) Annexin 5 fitc pi cell apoptosis detection kit, by BestBio (1 mentions) Superscript 2, by Thermo Fisher Scientific (1 mentions) Recombinant rnasin ribonuclease inhibitor, by Promega (1 mentions)

Spelling variants of this product

SYBR Green Mixture (41 citations) SYBR Green Master Mixture (25 citations) SYBR Master Mixture Kit (10 citations) SYBR Green II Mixture (10 citations) SYBR Green PCR Master Mixture (5 citations) SYBR Green qPCR mixture (4 citations) 2X Ultra SYBR Mixture kit (3 citations) Ultra SYBR mixture (SYBR Green I, (2 citations) SYBR Premix EX Tag Master mixture kit (2 citations) SYBR Green Real-time PCR Master Mixture (2 citations)

16 protocols using sybr mixture

1

Quantitative Analysis of Circular RNA and mRNA Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
First, total RNA was isolated using TRIzol reagent (Beyotime). Then, total RNA was reverse assembled into cDNA with the use of a PrimeScript RT kit (Takara) or miRNA First‐Strand cDNA kit (Tiangen) in accordance with the manufacturer's protocols. Finally, SYBR mixture (Takara) was applied for cDNA quantification. In this study, β‐actin or U6 acted as an internal reference, and relative expression was processed via the 2−ΔΔCT method. Primers are listed below:
Circ‐PDZD8, F: 5′‐ACATGACCAGCTTACGTTGA‐3′ and R: 5′‐ATAAGTCGATCTCCCCGCTG‐3′; PDZD8, F: 5′‐CTTCGGGAGCGTCTGAGGAG‐3′ and R: 5′‐CATTTTGAGGACATCGGGCG‐3′; miR‐330‐5p, F: 5′‐GCCTCTCTGGGCCTGTGTC‐3′ and R: 5′‐CAGTGCAGGGTCCGAGGTAT‐3′; LARP1, F: 5′‐ACTCCATGCTTTGGAGGGTG‐3′ and R: 5′‐AGGTATGGGAGCCTCTTGGA‐3′; U6, F: 5′‐CGCTTCGGCAGCACATATAC‐3′ and R: 5′‐TTCACGAATTTGCGTGTCAT‐3′; β‐actin, F: 5′‐CCATGTACGTTGCTATCCAG‐3′ and R: 5′‐CTTCATGAGGTAGTCAGTCAG‐3′.
Zhu X., Du T., Chen X, & Hu P. (2023). Circ‐PDZD8 promotes cell growth and glutamine metabolism in non‐small cell lung cancer by enriching LARP1 via sequestering miR‐330‐5p. Thoracic Cancer, 14(22), 2187-2197.
+ Open protocol
+ Expand
2

Quantifying Gene Expression in Huh7 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA of Huh 7 cells and total liver-tumor RNA from all groups were extracted with total RNA isolation kits (RNAeasy; Beyotime, China), and cDNA was synthetized using PrimeScript Reagent kits with gDNA Eraser (cat. no. RR047A; Takara Biotechnology Co., Ltd.) following standard protocols. Relative expression of target genes as determined by qPCR using SYBR Mixture (Takara Biotechnology Co., Ltd.) performed in 25 µL volumes with 2 µL cDNA, 400 nM of each sense and antisense primer and 12.5 µL Brilliant SYBR Green QPCR Master Mix (Takara Bio, Inc.) on an ABI PRISM 7000 sequence detection system (Applied Biosystems, ThermoFisher Scientific, Inc.). The reaction was performed for 40 cycles of denaturation at 95°C for 30 s, annealing at 53°C for 30 s and extension at 72°C for 10 s. Primer sequences are shown in Supplementary Table 1. All experiments were repeated at least in triplicate with three independent replicates for each group. To quantify gene expression, the 2−ΔΔCt relative quantification method was used.
Huang L.L., Luo F.Y., Huang W.Q., Guo H., Liu Q., Zhang L., Jin A.S, & Sun H. (2023). Augmenter of Liver Regeneration Monoclonal Antibody Promotes Apoptosis of Hepatocellular Carcinoma Cells. Journal of Clinical and Translational Hepatology, 11(3), 605-613.
+ Open protocol
+ Expand
3

Necroptosis Regulation in Bone Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Pg-LPS was bought from Sigma (St. Louis, MO, USA). Rabbit RIP1, MLKL and beta-actin antibody was from Proteintech (USA), and mouse RIP3 antibody was from Santa (USA). Real-time PCR primer COL-1, OCN, RUNX-2, BSP, TNF-α, IL-1β, IL-18 and GAPDH were from Genecopoeia (USA), SYBR mixture was from Takara (Japan), RT Master Mix was from Takara (Japan). Inhibitor of Nec-1 (ab141053) was from Abcam (USA). Annexin V-FITC/PI: Cell apoptosis detection kit was from Bestbio Company (China). Nude mice were bought from Animal Center of the Fourth Military Medical University Animal Center.
Yan B., Zhang H., Dai T., Gu Y., Qiu X., Hu C., Liu Y., Wei K, & Li D. (2018). Necrostatin-1 promotes ectopic periodontal tissue like structure regeneration in LPS-treated PDLSCs. PLoS ONE, 13(11), e0207760.
+ Open protocol
+ Expand
4

ASPM Expression Analysis in MG-63 and U2OS

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from MG‐63 and U2OS cells by TRIzol Reagent (Invitrogen). Then total RNA was reverse‐transcribed using M‐MLV Reverse Transcriptase (Promega). A quantitative PCR assay was performed using SYBR mixture (Takara), and the relative expression levels of ASPM were normalized to GAPDH.
Lin P., Liang L., Dong Y., Ren Z., Zhao H, & Li G. (2020). Identification of Abnormal Spindle Microtubule Assembly as a Promising Therapeutic Target for Osteosarcoma. Orthopaedic Surgery, 12(6), 1963-1970.
+ Open protocol
+ Expand
5

KIF23 Expression Analysis in Cancer Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from MGC-803 and SGC-7901 cells using TRIzol Reagent (Invitrogen). Then, total RNA was reverse-transcribed by M-MLV reverse transcriptase (Promega). Quantitative real-time PCR was performed using SYBR mixture (Takara), and the relative expression of KIF23 was normalized to GAPDH.
Li X.L., Ji Y.M., Song R., Li X.N, & Guo L.S. (2019). KIF23 Promotes Gastric Cancer by Stimulating Cell Proliferation. Disease Markers, 2019, 9751923.
+ Open protocol
+ Expand
6

ASPM Expression Analysis in Lung Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from NCI-H520 and SK-MES-1 cells by Trizol reagent (Invitrogen), respectively. Then the total RNAs was reverse-transcribed by M-MLV reverse transcriptase (Promega). Meanwhile, total RNAs were reverse transcribed to produce cDNA by cDNA synthesis system including dNTP-mix, primer-mix, 5×PrimeScript buffer, DTT and DEPC water. Quantitative PCR was subsequently conducted using SYBR mixture (Takara), and the relative expression level of ASPM was normalized to the expression of GAPDH.
Yuan Y.J., Sun Y., Gao R., Yin Z.Z., Yuan Z.Y, & Xu L.M. (2020). Abnormal spindle-like microcephaly-associated protein (ASPM) contributes to the progression of Lung Squamous Cell Carcinoma (LSCC) by regulating CDK4. Journal of Cancer, 11(18), 5413-5423.
+ Open protocol
+ Expand
7

Total RNA Extraction and Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
U251 and U87 cells were lysed for total RNAs extraction by Trizol reagent (Invitrogen, Carlsbad, CA). Subsequently, M-MLV reverse transcriptase were utilized to reverse transcribe RNA to cDNA. SYBR mixture (Takara, Kusatsu, Japan) was used to amplify genes. And targeted gene levels were normalized to GAPDH.
Shao S., Fan Y., Zhong C., Zhu X, & Zhu J. (2020). Coactosin-Like Protein (COTL1) Promotes Glioblastoma (GBM) Growth in vitro and in vivo. Cancer Management and Research, 12, 10909-10917.
+ Open protocol
+ Expand
8

Quantification of MLCK mRNA in H9C2 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from H9C2 cells by TRIzol. cDNA was synthesized using the SuperScript II (Invitrogen). The mRNA levels of MLCK were quantified using the SYBR mixture (Takara Biotechnology co., ltd.) on an ABI-7900 System. GAPDH levels were utilized as references for MLCK. All mRNA expression was calculated by 2−ΔΔct. The primers were synthesized by GenePharma. MLCK forward: 5′-GCTGCCTGACCACGAATATAAG-3′, reverse: 5′-GACACCATCCACTTCATCCTTC-3′. GAPDH forward: 5′-CGCTAACATCAAATGGGGTG-3′ and reverse: 5′-TTGCTGACAATCTTGAGGGAG-3′.
Zhang Q., Liu X., Yi W, & Zhang C. (2022). Myosin Light Chain Kinase Modulates to Improve Myocardial Hypoxia/Reoxygenation Injury. Journal of Healthcare Engineering, 2022, 8124343.
+ Open protocol
+ Expand
9

Quantitative PCR Analysis of NCAPH

Check if the same lab product or an alternative is used in the 5 most similar protocols
The study was approved by the ethical committee of the First Affiliated Hospital, and the College of Clinical Medicine of Henan University of Science and Technology, and informed consent was provided by all patients. Total RNA was extracted from cells using Trizol reagent (15596-018, Invitrogen). Quantitative PCR was subsequently conducted via SYBR mixture (RR420A, Takara). Total RNA was reverse transcribed into cDNA at 42 8C for 1 h using M-MLV reverse transcriptase (cat. no. M1701; Promega Corporation, includes M-MLV 5X Reaction Buffer 5 μL, dNTP, 10 mM 1.25 μL, Recombinant RNasin ® Ribonuclease Inhibitor 25 units, M-MLV RT 200 units, and Nuclease-Free Water to final volume 25 μL). NCAPH mRNA levels were normalized to GAPDH. PCR primer sequences of NCAPH were: forward, 5 0 -AAA-CAACCTCAATGTCTCCGAAG-3 0 and reverse, 5 0 -ACAACCTAACTCT GGCAACTCG -3 0 . The following thermocycling conditions were used: Initial denaturation at 95 8C for 3 min; followed by 30 cycles of denaturation at 95 8C for 30 s, annealing at 58 8C for 30 s and extension at 72 8C for 30 s. The 2-ΔΔCq method was used to quantify the results.
Zhang T., Li P., Guo W., Liu Q., Qiao W, & Deng M. (2022). NCAPH promotes proliferation as well as motility of breast cancer cells by activating the PI3K/AKT pathway. Physiology international.
+ Open protocol
+ Expand
10

Quantifying SMYD2 Expression in Cervical Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA was extracted from cervical cancer cells by Trizol reagent (Invitrogen). Subsequently total mRNA was reverse-transcribed by M-MLV reverse transcriptase (Promega). Quantitative PCR was conducted using SYBR mixture (Takara), and the relative expression level of SMYD2 was normalized to GAPDH.
Sun J.J., Li H.L., Ma H., Shi Y., Yin L.R, & Guo S.J. (2019). SMYD2 promotes cervical cancer growth by stimulating cell proliferation. Cell & Bioscience, 9, 75.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!