Abi prism 7500 sequence detection system

Manufactured by PerkinElmer

Sourced in United States

The ABI Prism 7500 Sequence Detection System is a real-time PCR instrument designed for quantitative gene expression analysis. It provides accurate and reliable measurements of nucleic acid sequences in a variety of sample types. The system utilizes fluorescent detection technology to monitor the amplification of target sequences in real-time.

Automatically generated - may contain errors

Lab products found in correlation

Trizol reagent, by Thermo Fisher Scientific (3 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Express one step sybr greener kit, by Thermo Fisher Scientific (1 mentions) M mlv reverse transcriptase, by Thermo Fisher Scientific (1 mentions) Abi prism 7500, by PerkinElmer (1 mentions) Qscript kit, by Quanta Biosciences (1 mentions) Rna extraction kit, by Thermo Fisher Scientific (1 mentions) Taqman mir reverse transcription kit, by Thermo Fisher Scientific (1 mentions) Hiscript 2 q rt supermix for qpcr gdna wiper kit, by Vazyme (1 mentions) Sybr green pcr kit, by Toyobo (1 mentions) Sybr green mix, by Thermo Fisher Scientific (1 mentions) Primescript first strand cdna synthesis kit, by Takara Bio (1 mentions) Quantitect sybr green pcr kit, by Qiagen (1 mentions)

Close spelling variants of this product

ABI Prism 7500

7 protocols using abi prism 7500 sequence detection system

Quantification of Gene Expression by Real-Time PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNAs from the cells were extracted using TRIzol reagent (Invitrogen, Thermo Fisher), followed by transcribed into cDNA using M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA, USA). Realtime PCR quantification was performed using EXPRESS One-Step SYBR™ GreenER™ Kit (Thermo Fisher) on a ABI Prism 7500 Sequence Detection System (Perkin Elmer Inc., Waltham, MA, USA). The thermocycling conditions applied were listed as follows: 98°C for 3 min; followed by 40 cycles at 98°C for 30 s, 60°C for 30 s and 72°C for 30 s. The relative expressions of genes were calculated using the comparative 2^−ΔΔCt method. ACTIN was used as the inner control. The primers used are described in Table 1.Table 1

Sequences of Primers

Primer Name	Sequence (5ʹ-3ʹ)
MIR155HG	Forward: TGGAGATGGCTCTAATGGTGG
MIR155HG	Reverse: TCAGTTGGAGGCAAAAACCC
SRSF1	Forward: GCGACGGCTATGATTACGATG
SRSF1	Reverse: ACATACATCACCTGCTTCACGC
PTBP1	Forward: ACCCTGTGACCCTGGATGT
PTBP1	Reverse: TGTACTTGACGTTGAGGCTGGT
IGF2BP2	Forward: CAGACAATGGCGATGACCACT
IGF2BP2	Reverse: AGTGACCTTCTCCCGGAACAC
ACTIN:	Forward: GTCCACCGCAAATGCTTCTA
ACTIN:	Reverse: TGCTGTCACCTTCACCGTTC

Shen L., Li Y., Hu G., Huang Y., Song X., Yu S, & Xu X. (2020). MIR155HG Knockdown Inhibited the Progression of Cervical Cancer by Binding SRSF1. OncoTargets and therapy, 13, 12043-12054.

+ Open protocol

+ Expand

Real-Time PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from cells and tissues using the Zymo Quick RNA (Zymo Research, Irvine, CA 92614). mRNA was reverse transcribed into cDNA using Agilent AffinityScript (Agilent, Santa Clara, CA 95051). Gene expression was analyzed by real-time (RT)-PCR, using the TaqMan system based on real-time detection of accumulated fluorescence (ABI Prism 7500; PerkinElmer, Foster City, CA). Fluorescence for each cycle was quantitatively analyzed by an ABI Prism 7500 Sequence Detection System (PerkinElmer). To control variation in the amount of DNA that was available for PCR in the different samples, gene expression of the target sequence was normalized in relation to the expression of an endogenous control, 18S rRNA (18S rRNA TaqMan Control Reagent kit, ABI Prism 7500; PerkinElmer). Details of primers and TaqMan probes for these genes have been previously reported [9 (link)]. Each experiment was conducted in four to six replicates. Results were expressed relative to control (untreated) cells/tissue, which were arbitrarily assigned a value of 1.

Wang B., Ding C., Ding X., Tesch G., Zheng J., Tian P., Li Y., Ricardo S., Shen H.H, & Xue W. (2022). WNT1-inducible signaling pathway protein 1 regulates kidney inflammation through the NF-κB pathway. Clinical Science (London, England : 1979), 136(1), 29-44.

+ Open protocol

+ Expand

miRNA Expression Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from cells or serum following the induction of the model using an RNA extraction kit (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). cDNA was reverse transcribed using a Q-script kit (Quanta Biosciences, Gaithersburg, MD, USA) and a TaqMan miR reverse transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) at 37°C for 1 h followed by 82°C for 10 sec. qPCR was performed using an ABI Prism 7500 Sequence Detection System (Perkin-Elmer Inc., Waltham, MA, USA) and a standard SYBR Green PCR kit (Toyobo Life Science, Osaka, Japan). The temperature protocol was as follows: Initial denaturation at 95°C for 5 min; followed by 40 cycles of denaturation at 95°C for 30 sec, annealing at 60°C for 30 sec and elongation at 72°C for 30 sec. Primer sequences were as follows: miR-214, forward, 5′-AGCATAATACAGCAGGCACAGAC-3′ and reverse, 5′-AAAGGTTGTTCTCCACTCTCTCAC-3′; U6, forward, 5′-ATTGGAACGATACAGAGAAGATT-3′ and reverse, 5′-GGAACGCTTCACGAATTTG-3′. Results were analyzed using the 2^−ΔΔCq method (12 (link)).

Yang S., Fei X., Lu Y., Xu B., Ma Y, & Wan H. (2019). miRNA-214 suppresses oxidative stress in diabetic nephropathy via the ROS/Akt/mTOR signaling pathway and uncoupling protein 2. Experimental and Therapeutic Medicine, 17(5), 3530-3538.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted as a different set of biological samples under the same conditions as those used in RNA-Seq. Three independent biological replicates were performed for each sample. The extracted RNA was used to synthesize cDNA using a Hiscript II Q RT SuperMix for qPCR (+gDNA wiper) Kit (Vazyme, Nanjing, China) according to the manufacturer’s instructions. qPCR was performed using the ABI Prism 7500 sequence detection system (Perkin-Elmer, Waltham, MA) with SYBR Green I fluorescent dye detection (Vazyme, Nanjing, China). A house-keeping gene act encoding for the actin protein was chosen as the endogenous control. The primers used for qPCR are listed in Supplementary Table 5 and a 2^−ΔCt method^{50 (link)} was used to analyse the relative changes in gene expression.

Yang J., Yin Z.Q., Kang Z.T., Liu C.J., Yang J.K., Yao J.H, & Luo Y.Y. (2017). Transcriptomic profiling of Alternaria longipes invasion in tobacco reveals pathogenesis regulated by AlHK1, a group III histidine kinase. Scientific Reports, 7, 16083.

+ Open protocol

+ Expand

Quantifying miRNA and mRNA Expression in Kidney Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from kidney tissue following the induction of the model using TRIzol reagent (Thermo Fisher Scientific, Inc.). According to the instructions of the TaqMan reverse transcription kit (cat. no. N8080234; Invitrogen; Thermo Fisher Scientific, Inc.), RNA was reverse transcribed into cDNA. The following thermocycling conditions were used (miR-214): Initial denaturation at 95°C for 5 min; followed by 40 cycles of denaturation at 95°C for 30 sec, annealing at 60°C for 30 sec and elongation at 72°C for 30 sec. RT-qPCR was performed using an ABI Prism 7500 Sequence Detection System (PerkinElmer, Inc.) and a standard SYBR Green PCR kit (Toyobo Life Science). U6 was used as the internal control for miR-214. Primer sequences were as follows: miR-214, forward, 5′-AGCATAATACAGCAGGCACAGAC-3′ and reverse, 5′-AAAGGTTGTTCTCCACTCTCTCAC-3′; U6, forward, 5′-ATTGGAACGATACAGAGAAGATT-3′ and reverse, 5′-GGAACGCTTCACGAATTTG-3′. These experiments were replicated six times. Results were analyzed using the 2^−ΔΔCq method (14 (link)). The mRNA expression levels of LC3, p62, PTEN, AKT and mTOR were evaluated via RT-qPCR. With β-actin as an internal reference of these genes, the 2^−ΔΔCq was used to measure the relative expression of target genes. The primer sequences shown in Table I were synthesized by Sangon Biotech Co., Ltd.

Sang Z., Dong S., Zhang P, & Wei Y. (2021). miR-214 ameliorates sepsis-induced acute kidney injury via PTEN/AKT/mTOR-regulated autophagy. Molecular Medicine Reports, 24(4), 683.

+ Open protocol

+ Expand

Quantifying RANK Isoform Expression in Endometrial Cancer

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

OriGene endometrial cancer array supplemented plates were loaded into each well with 30 µL of a master mix stock solution containing 2× SYBR green mix (Life technologies, Carlsbad, CA, USA), water, and specific primers at 0.05 µm final concentration. The sequence of primers for β-actin, RANK (TNFRSF11A) and its variant RANK isoforms lacking exon 9 (TNFRSF11A_Δ9), exons 8–9 (TNFRSF11A_Δ8,9), and exons 7–9 (TNFRSF11A_Δ7,8,9), has been previously described [20 (link)]. Real-time PCR was performed using an ABI PRISM 7500 Sequence Detection System (Perkin Elmer Corp., Norwalk, CT, USA) according to the manufacturer instructions with a heated lid (105 °C), an initial denaturation step at 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. Relative expression level of RANK was calculated with the comparative 2^ΔΔ^C^t method, where ΔC_t = C_t(target) − C_t(control), ΔΔC_t = C_t(target) − C_{t(calibrator)} and all samples were normalized to the β-actin gene.
In order to quantify alterations in profiling pattern of RANK isoforms associated with cancer parameters, the expression of each RANK isoform per case was normalized by dividing its specific 2^ΔΔ^C^t value by the summation of 2^ΔΔ^C^t values from the four RANK isoforms. Results were expressed as percentage.

Gómez R., Castro A., Martínez J., Rodríguez-García V., Burgués O., Tarín J.J, & Cano A. (2018). Receptor Activator of Nuclear Factor Kappa B (RANK) and Clinicopathological Variables in Endometrial Cancer: A Study at Protein and Gene Level. International Journal of Molecular Sciences, 19(7), 1848.

+ Open protocol

+ Expand

Quantifying NEAT1 expression in A549 and NCI-H1975 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from A549 and NCI-H1975 cells using TRIzol (Thermo Fisher Scientific). The extracted RNA was reverse-transcribed into cDNA using the PrimeScript First Strand cDNA synthesis kit (Takara, Dalian, China). Real time qPCR was performed using QuantiTect SYBR Green PCR Kits (Qiagen, Hilden, Germany) on an ABI Prism 7500 Sequence Detection System (Perkin-Elmer Inc., Waltham, MA, USA). Relative gene expression was normalized to ACTIN. All procedures followed the manufacture’s protocols. The primer sequences were NEAT1: sense, 5′-AGTGATGTGGAGTTAAGGCGC-3′; antisense, 5′-CGGGCTTACCAGATGACCAG-3′. ACTIN: sense, 5′-GTCCACCGCAAATGCTTCTA-3′; antisense, 5′-TGCTGTCACCTTCACCGTTC-3′.

Gu G., Hu C., Hui K., Chen T., Zhang H, & Jiang X. (2021). NEAT 1 knockdown enhances the sensitivity of human non-small-cell lung cancer cells to anlotinib. Aging (Albany NY), 13(10), 13941-13953.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!