Rneasy minelute cleanup column

Manufactured by Qiagen

Sourced in China, Germany, United States

The RNeasy MinElute Cleanup columns are a tool designed for the purification and concentration of RNA samples. They are used to remove contaminants and impurities from RNA samples, allowing for the recovery of high-quality RNA suitable for various downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

RNeasy columns (885 citations) MinElute columns (143 citations) RNeasy MinElute columns (70 citations) RNeasy MinElute (28 citations) RNeasy MinElute Cleanup (19 citations) Column cleanup (6 citations) RNeasy column cleanup (5 citations) RNeasy MinElute Cleanup Kit columns (2 citations)

8 protocols using rneasy minelute cleanup column

RNA Sequencing for Developmental Stages

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated with TRIzol reagent (Invitrogen, Carlsbad, CA, USA), treated with DNase I (Qiagen, Beijing, China), and purified using an RNeasy MinElute Cleanup column (Qiagen). The total RNA integrity was assessed using Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA), and only the samples with RNA Integrity Number (RIN) scores >8 were used for sequencing. Equal amounts of total RNA from the samples at the different stages (i.e., 50, 55, 60, 65 and 75 dpc) were pooled into one sample.
PolyA⁺ RNA was purified using Magnetic Oligo (dT) Beads from 20 μg of the total RNA and was further fragmented before cDNA synthesis. First-strand cDNA was synthesized using Random Primer p(dN)₆ and Superscript III (Invitrogen, Carlsbad, CA, USA), and the synthesis of double-stranded cDNA was performed using 10× second strand buffer, RNaseH, and DNA Polymerase I. Following the second-strand cDNA synthesis and adaptor ligation, 240–310 bp cDNA fragments were isolated. The cDNA libraries were then prepared following the manufacturer's instructions (Illumina, San Diego, CA, USA). The purified cDNA libraries were sequenced using a paired-end sequencing strategy on the Illumina HiSeq 2000 after quantification by the Agilent 2100 Bioanalyzer.

Zhao W., Mu Y., Ma L., Wang C., Tang Z., Yang S., Zhou R., Hu X., Li M.H, & Li K. (2015). Systematic identification and characterization of long intergenic non-coding RNAs in fetal porcine skeletal muscle development. Scientific Reports, 5, 8957.

+ Open protocol

+ Expand

Transcriptome-wide Poly(A) Tail Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

TAIL-Seq TAIL-seq was performed as described previously (Chang et al., 2014) . In brief, 90 mg of total RNA extracted by TRIzol (Life Technologies) was DNase-treated and purified (>200 nt) by RNeasy MinElute cleanup column (QIAGEN). rRNAs were depleted by using Ribo-Zero kit (Epicenter) and remaining RNAs were ligated to the biotinylated 3 0 adaptor and partially digested by RNaseT1 (Ambion). Fragmented RNAs were pulled-down by streptavidin beads and eluted RNAs were phosphorylated at the 5 0 end. RNAs were size-fractionated by gel purification (500-1,000 nt), and purified RNAs were ligated to 5 0 adaptor, reverse-transcribed, and amplified by PCR. PCR products were purified using AMPure XP beads (Beckman), and cDNA libraries were sequenced by Illumina HiSeq 2500 (51 3 251 bp paired end run) with PhiX control library and spike-in mixture with various poly(A) lengths.

Park J.E., Yi H., Kim Y., Chang H, & Kim V.N. (2016). Regulation of Poly(A) Tail and Translation during the Somatic Cell Cycle. Molecular cell, 62(3).

+ Open protocol

+ Expand

RNA Extraction and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

For microarray analysis and Northern blotting total RNA was extracted from the cell pellets using IsolRNA (5prime) and DNA was removed using the DNA-free kit (Applied Biosystems). DNase-treated total RNA was subsequently run through RNeasy MinElute Cleanup columns (Qiagen) to remove any remaining contaminants, and to further concentrate the RNA. The RNA was finally dissolved in 16 μl RNase free water.

Thode S.K., Kahlke T., Robertsen E.M., Hansen H, & Haugen P. (2015). The immediate global responses of Aliivibrio salmonicida to iron limitations. BMC Microbiology, 15(1), 9.

+ Open protocol

+ Expand

Cloning and Sequencing of Embryonic cDNA Library

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from developing embryos using TRIzol reagent (Gibco-BRL, Grand Island, New York, USA) according to the manufacturer’s instructions and further purified using RNeasy MinElute Cleanup columns (Qiagen, Hilden, Germany). PolyA+ RNA was isolated using the Poly(A) Purist kit (Ambion) according to manufacturer’s instruction. A cDNA library was prepared using the Creator SMART cDNA Library Construction Kit (BD Biosciences, San Jose, California, USA) as directed by the manufacturer’s instructions. cDNAs above ∼500 bp were directionally cloned into Clontech pDNR-LIB vector after SfiI digestion. Gel analysis of a trial transformation showed 100% recombinants with inserts ranging in size from 450 bp to 1.5 kbp and 90% of inserts >500 bp. The ligated library was provided to The Institute for Genomic Research (TIGR, Rockville MD) for electro-transformation and sequencing. Clones were sequenced from the 5′ end of cDNA inserts using the Sanger method and the universal T7 primer (TAATACGACTCACTATAGGG).

Slabaugh M.B., Cooper L.D., Kishore V.K., Knapp S.J, & Kling J.G. (2015). Genes affecting novel seed constituents in Limnanthes alba Benth: transcriptome analysis of developing embryos and a new genetic map of meadowfoam. PeerJ, 3, e915.

+ Open protocol

+ Expand

Strand-specific RNA-seq Library Generation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Strand-specific RNA-seq libraries were generated with the Illumina primer ligation method, as described [62 (link)] with the modifications described in [61 (link)]. In brief, after depletion of ribosomal RNAs using the MICROBExpress Kit (Ambion), RNA was treated with TAP (Tebu-Bio), fragmented using the RNA fragmentation Reagent kit (Ambion). Dephosphorylation of the fragmented RNA by using the antarctic phosphatase (Biolabs), and rephosphorylation with the T4 polynucleotide kinase (Biolabs) were followed by a purification step through RNeasy MinElute Cleanup columns (Qiagen). The RNA was then successively ligated to the 3′ RNA adapter (Illumina TruSeq Small RNA kit) by using truncated T4 RNA ligase 2 (Biolabs) and to the 5′ RNA adapter (Illumina TruSeq Small RNA kit) with T4 RNA ligase (Biolabs). RNA ligated to the two adapters was reverse-transcribed with the Superscript II Reverse Transcriptase (Life Technologies) and the RNA reverse transcription primer (Illumina TruSeq Small RNA kit). The resulting cDNAs were amplified for 13 PCR cycles with Phusion Taq polymerase using the RP1 primer and one of the indexed PCR primers (Illumina TruSeq Small RNA kit).

Rosinski-Chupin I., Sauvage E., Sismeiro O., Villain A., Da Cunha V., Caliot M.E., Dillies M.A., Trieu-Cuot P., Bouloc P., Lartigue M.F, & Glaser P. (2015). Single nucleotide resolution RNA-seq uncovers new regulatory mechanisms in the opportunistic pathogen Streptococcus agalactiae. BMC Genomics, 16(1), 419.

+ Open protocol

+ Expand

Directional RNA-Seq for MHV68 Transcriptome

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from TRIzol (Life Technologies) as described previously (6 (link)) at 6 or 18 hpi. Poly(A)-selected RNA was chemically fragmented using RNA fragmentation reagents (Life Technologies) and purified using RNeasy MinElute cleanup columns (Qiagen). Directional RNA-Seq libraries were generated using 600 ng of fragmented 18-hpi RNA according to Illumina’s directional mRNA-Seq protocol or 200 ng of 6 hpi RNA according to Illumina’s directional Tru-Seq protocol. Nucleotides with a Phred quality score less than 20 were trimmed from the 3′ ends of raw Illumina reads. Trimmed reads with a mean quality score less than 10 or a length less than 20 were discarded. Reads were then mapped to mouse rRNA, MHV68 genome (GenBank accession number U97553), and mouse genome sequences (Build 37) with the short-read aligning program Bowtie-0.12.5 (60 (link)). Bowtie alignments were performed using the parameter setting “-best” and the settings “-e 420” and “-e 600” for 76-nucleotide and 100-nucleotide reads, respectively. Bowtie output from the MHV68 genome mapping was converted to WIG (wiggle track format) files of read depth coverage, on a log₂ scale and visualized using Gbrowse (http://www.gbrowse.org). Correlation coefficients between read depth coverage, and tiled array signals were calculated using Spearman’s ranked correlation coefficient in the R statistical environment.

Canny S.P., Reese T.A., Johnson L.S., Zhang X., Kambal A., Duan E., Liu C.Y, & Virgin H.W. (2014). Pervasive Transcription of a Herpesvirus Genome Generates Functionally Important RNAs. mBio, 5(2), e01033-13.

+ Open protocol

+ Expand

Total RNA Isolation and Purification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from tissue samples using TRIZOL reagent (Life Technologies, Inc., Carlsbad, CA) and then further purified using RNeasy Min-elute Clean-up Columns (Qiagen, Valencia, CA), according to the manufacturer's instructions. RNA concentration and 260/280 absorbance ratio (A_260/280) were measured with Infinite M200 spectrophotometer (Tecan). RNA integrity was assessed with RNA 6000 Nano LabChip kit using the Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, USA) and the RNA integrity number (RIN) generated with Agilent 2100 Expert software [14] . One microgram of total RNA was reverse transcribed using random hexamers in a final volume of 20 µl, according to the SuperScript TM II Reverse Transcriptase protocol (Invitrogen Life Technologies, Carlsbad, CA, USA). All cDNA samples were diluted to 5 ng/µl, dispensed in a 96wells plates and stored at −20°C until use.

Romani C., Calza S., Todeschini P., Tassi R.A., Zanotti L., Bandiera E., Sartori E., Pecorelli S., Ravaggi A., Santin A.D, & Bignotti E. (2014). Identification of Optimal Reference Genes for Gene Expression Normalization in a Wide Cohort of Endometrioid Endometrial Carcinoma Tissues. PLoS ONE, 9(12), e113781.

+ Open protocol

+ Expand

Small RNA Sequencing from Tumor Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

Whole RNA from tumor set 1 was extracted using TRIzol (Life Technologies, MD, USA) according to the manufacturer's instructions. RNAs from tumor set 2 were further purified using RNeasy MinElute Cleanup columns (Qiagen, Valencia, CA, USA). The integrity of RNA was assessed using Agilent BioAnalyzer 2100 (Agilent Technologies).
RNA samples were processed as described in the 'TruSeq Small RNA Sample Preparation Guide' (Illumina part # 15004197 Rev. A of November 2010). Briefly, 1 μg of purified total RNA containing the small fraction of RNA was sequentially ligated to 3' and 5' adapters using the truncated form of T4 RNA ligase 2 and the T4 RNA ligase, respectively. Reverse transcription with SuperScript II reverse transcriptase was then used to yield cDNA adapterligated libraries that were amplified by PCR with Phusion DNA polymerase and Illumina RNA PCR primers. cDNA-amplified libraries were pooled and separated by polyacrylamide gel electrophoresis, and a fraction of 145-160 bases was extracted. The purified fraction constituted the multiplexed, purified libraries that were applied to an Illumina flow cell to generate clusters, and sequenced on the Genome Analyzer IIx with SBS TruSeq v5 reagents following manufacturer's protocols.

Mancikova V., Castelblanco E., Pineiro-Yanez E., Perales-Paton J., de Cubas A.A., Inglada-Perez L., Inglada-Perez L., Matias-Guiu X., Capel I., Bella M., Lerma E., Riesco-Eizaguirre G., Santisteban P., Maravall F., Mauricio D., Al-Shahrour F, & Robledo M. (2015). MicroRNA deep-sequencing reveals master regulators of follicular and papillary thyroid tumors. Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc, 28(6).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!