Sybr green 1 dye master mix

B cells plated in 12-well plates (5×10⁵ cells per ml) were treated with DMSO, batyl alcohol or chimyl alcohol (100 nM) in the presence of stimuli for 5 days. Total RNA was isolated from cultured B cells using RNeasy mini kit (Qiagen). 0.5 µg RNA was reverse-transcribed into cDNA using Oligo-dT. Real-time PCR with SYBR Green dye (BioRad) was performed using ABI 7300 system. The Germline (GL) IgG (γ1) primers were: forward, 5′- GGCCCTTCCAGATCTTTGAG-3′; reverse, 5′- GGATCCAGAGTTCCAGGTCACT -3′. The GAPDH mRNA (forward, 5′- TTAGCACCCCTGGCCAAGG-3′; reverse, 5′- CTTACTCCTTGGAGGCCATG-3′) was used as internal control for RNA integrity and RT-PCR amplification. The relative expression level of transcript was determined using standard curve method after GAPDH normalization. The quantitative real-time PCR was performed using the following conditions. Reaction mixtures contained 12.5 µl of SYBR Green I dye master mix (Applied Biosystems), 2 pmol/L each of forward and reverse primers, and 5 µl of 100 times diluted cDNA. PCR reactions were run in triplicate (95°C for 10 min, and 40 cycles of 95°C for 15 s, 58°C for 30 s and 72°C for 30 s).

RNA extraction was performed with Qiagen mRNA extraction kit according to standard protocol. cDNA was synthesized from 1μg of total RNA with First Strand System according to standard protocol (Invitrogen Inc. NY). Real-time PCR was performed with SYBR Green I dye master mix (Applied Biosystems Foster City, CA). Primers (Integrated DNA Technologies, Inc. Coralville, IA) were: 18s rRNA forward (F), 5′-CCT GCG GCT TAA TTT GAC TCA-3′ and reverse (R), 5′-AGC TAT CAA TCT GTC AAT CCT GTC C-3; glyceraldehyde-3-phosphate dehydrogenase F, 5′-TGA CAA CTT TGG TAT YCG TGG AAG G-3′ and R, 5′-AGG CAG GGA TGA TGT TCT GGA GAG-3′ (reference genes); ERβ2 F, 5-ACT TGC TGA ACG CCG TGA CC-3 and R, 5′-CCA TCG TTG CTT CAG GCA A-3′; Twist1 F, 5′-GGA GTC CGC AGT CTT ACG AG-3′ and R, 5′-TCT GGA GGA CCT GGT AGA GG-3′. qPCR reactions were performed with a 7500 Fast Real-Time PCR System (Applied Biosystems) using optimized conditions for SYBR Green I dye system: 50 C for 2 minutes, 95 C for 10 minutes, followed by 40–50 cycles at 95 C for 15 seconds and 60 C for 50 seconds. Optimum primer concentration was determined in preliminary experiments, and amplification specificity confirmed by dissociation curve analysis.

Real-time PCR was performed with the SYBR Green I dye master mix (Applied Biosystems, Foster City, CA). qPCR reactions were analysed using a 7500 Fast Real-Time PCR System (Applied Biosystems) applying the following conditions: 95°C for 20 sec, followed by 40 cycles at 95°C for 3 sec and 60°C for 30 sec. Primer sequences for analysed genes were: ERβ1/ERβ2 forward 5′-TCCATGCGCCTGGCTAAC-3′, ERβ1 reverse 5′-CAGATGTTCCATGCCCTTGTTA-3′, ERβ2 reverse 5′-CCATCGTTGCTTCAGGCAA-3′, PHD3 forward 5′-GCCGGCTGGGCAAATACTA-3′, reverse 5′-CCGGATAGCAAGCCACCAT-3′, TGFB3 forward 5′-TACTATGCCAACTTCTGCTCAG-3′, reverse 5′-AACTTACCATCCCTTTCCTC-3′, GAB1 forward 5′-CCTGTTGCTCATCAACTGTCAAAGC-3′, reverse 5′-CTACACTCGATGTCCCAGATGGG-3′, E2F2 forward 5′-TGAGGACAAGGCCAACAAGAG-3′, reverse 5′-TTGCCAACAGCACGGATATC-3′, RECK forward 5′-AACAGGCCAACAGAACTTTTCAG-3′, reverse 5′-CATGTCATTCATGGCTCCTTGA-3′, ERα forward 5′-GCTACGAAGTGGGAATGATGAAAG-3′, reverse 5′-TCTGGCGCTTGTGTTTCAAC-3′. mRNA expression levels were normalized to acidic ribosomal phosphoprotein P0 (36B4) mRNA[39 (link)] reference gene forward 5′-GTGTTCGACAATGGCAGCAT-3′, reverse 5′-GACACCCTCCAGGAAGCGA-3′ or to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) reference gene forward 5′-GACCCCTTCATTGACCTCAACT-3′, reverse 5′-GAATTTGCCATGGGTGGAAT-3′.