DNA EMSA reactions were performed using a 248 bp DNA fragment radio-labeled by PCR, as previously described (Hartlepp et al., 2005 (link)) or a 40 bp Cy5-end labeled fragment (5'-Cy5-CCTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTA-3'; Eurofins MWG). The Cy5-labeled DNA was incubated with recombinant proteins in 1X binding buffer (50 mM Hepes pH7.6, 50 mM NaCl, 2 mM MgCl2, 10% glycerol and 100 ng/µl BSA) for 20 min on ice and was analyzed by native PAGE. The label was detected with a Fujifilm Phosphoimager FLA-3000. Mononucleosomes for EMSAs were generated by salt gradient dialysis as previously described (Dyer et al., 2004 (link)) using recombinant Drosophila histone octamers and either a 200 bp DNA fragment or a 151 bp DNA fragment, both comprising derivatives of the Widom 601 nucleosome positioning sequence. The DNA fragments were released by restriction enzyme digest with NotI and XmaI, respectively, from plasmids comprising 12 repeats of the 200 bp fragment (Huynh et al., 2005 (link)) or four repeats of the 151 bp fragment (Mueller-Planitz et al., 2013 (link)). The XmaI ends of the 151 bp fragment were labeled with dCTP-Cy5 and Klenow polymerase. The mononucleosomes EMSA reactions were performed and analyzed like DNA EMSAs as described above. Unlabeled mononucleosomes were visualized by ethidium bromide staining.
Fla 3000 phosphoimager
Manufactured by Fujifilm
Sourced in Japan
The FLA-3000 phosphoimager is a versatile laboratory instrument designed for the detection and analysis of radioactive samples. It utilizes a high-resolution imaging system to capture and digitize images of phosphor-based screens, enabling the quantification of radioactive signals. The FLA-3000 is capable of detecting a wide range of radioisotopes, including 32P, 35S, and 14C, making it a valuable tool for a variety of research applications.
Automatically generated - may contain errors
Lab products found in correlation
Tnt t7 quick coupled system, by Promega (3 mentions)
Multi gauge software, by Fujifilm (1 mentions)
Endo h, by New England Biolabs (1 mentions)
Tnt sp6 quick coupled system, by Promega (1 mentions)
Easytag express35s protein labeling mix, by PerkinElmer (1 mentions)
Zen blue, by Zeiss (1 mentions)
Tissue tek, by Sakura Finetek (1 mentions)
Nucleospin rna extraction kit, by Macherey-Nagel (1 mentions)
Aida image analyzer software, by Raytest (1 mentions)
10 protocols using fla 3000 phosphoimager
1
Electrophoretic Mobility Shift Assay for DNA and Nucleosomes
2
Small RNA Detection via Northern Blot and Phosphor Imaging
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Small RNAs were blotted and chemically crosslinked as described previously.62,64 (link) For detection of miRNAs, DNA oligonucleotides were 5´-radio-labeled by T4 Polynucleotide kinase and purified by Sephadex-G50 filtration. Hybridized filters were exposed to phosphor imager plates (Fujifilm) for 5–7 d. Plates were read by the Phosphoimager FLA3000 (Fujifilm, Düsseldorf) and images analyzed with the Multigauge Software (release 3.2).
3
Quantification of HSF-HSE Complexes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell extracts were prepared as described (Mezger et al, 1989 (link)). Pools of three embryos of the same litter were submitted to 2–4 rapid freeze–thaw cycles, in five volumes of extraction buffer. Whole cell extracts (30 μg of proteins) were incubated with a (32P)-labeled HSE oligonucleotide (5′-CTAGAACGTTCTAGAAGCTTCGAGA-3′), and complexes were separated on a native 4% polyacrylamide gel as described (Rallu et al, 1997 (link)). The components of the retarded complexes were analyzed by supershift using antibodies against HSF1 or HSF2 (10 ng/μl final; 3E2 and Ab4 neomarkers). The intensities of HSF–HSE complexes were quantified by PhosphoImager FLA3000 or 7000 (Fuji).
4
Characterization of Lep-derived Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The BB0173 Lep-derived constructs and BB0173 truncated constructs were transcribed and translated using the TNT T7 Quick Coupled System (Promega, Madison, WI). The reactions contained 75 ng of DNA template, 0.5 μl of [35S]Met (5μCi), and 0.25 μl of microsomes (tRNA Probes) were incubated for 90 min at 30 °C. The translation products were ultracentrifuged (100,000 g for 15 min) on a sucrose cushion, and analyzed by SDS-PAGE. The bands were quantified using a Fuji FLA-3000 phosphoimager and Image Reader 8.1j software.
For the proteinase K protection assay, 2 μl of proteinase K (1 mg/ml) was added to the sample, and the digestion reaction was incubated for 15 min on ice. Before SDS-PAGE analysis, the reaction was stopped by adding 1 mM phenylmethanesulfonyl fluoride (PMSF).
For EndoH (New England Biolabs, Beverly, MA) treatment, 1 μl of 10X Glycoprotein Denaturing Buffer, 1 μl of 10X GlycoBuffer, 1 μl of EndoH and 7 μl of H20 were added to make a 10 μl total reaction volume and incubated for 1 h at 37 °C with 0.1 mU of EndoH. The samples were analyzed by SDS-PAGE.
For the proteinase K protection assay, 2 μl of proteinase K (1 mg/ml) was added to the sample, and the digestion reaction was incubated for 15 min on ice. Before SDS-PAGE analysis, the reaction was stopped by adding 1 mM phenylmethanesulfonyl fluoride (PMSF).
For EndoH (New England Biolabs, Beverly, MA) treatment, 1 μl of 10X Glycoprotein Denaturing Buffer, 1 μl of 10X GlycoBuffer, 1 μl of EndoH and 7 μl of H20 were added to make a 10 μl total reaction volume and incubated for 1 h at 37 °C with 0.1 mU of EndoH. The samples were analyzed by SDS-PAGE.
5
In Vitro Translation of Membrane Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Constructs in pGEM1 were transcribed and translated in the TNT SP6 Quick Coupled System (Promega). 75 ng DNA template, 0.5 μL 35S-Met (5 μCi) and 0.25 μL microsomes (tRNA Probes) were added at the start of the reaction, and samples were incubated for 90 min at 30 °C. Translation products were diluted in 50 μL of loading buffer and analyzed by SDS–PAGE. The gels were quantified using a Fuji FLA-3000 phosphoimager and Image Reader 8.1j software. The membrane-insertion probability of a given TM sequence was calculated as the quotient between the intensity of the singly glycosylated band divided by the summed intensities of the singly glycosylated and doubly glycosylated bands.
6
In Vitro Translation and Proteinase K Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Lep-derived constructs and truncated constructs were transcribed and translated using the TNT T7 Quick Coupled System (Promega, Madison, WI). The reactions contained 75 ng of DNA template, 0.5 μl of EasyTag (5.5 μCi), and 0.25 μl of microsomes (tRNA Probes, College Station, TX) were incubated for 40 min at 30 °C. The translation products were ultracentrifuged (100,000×g for 15 min) on a sucrose cushion, and analysed by SDS-PAGE. The bands were quantified using a Fuji FLA-3000 phosphoimager and Image Reader 8.1j software.
For the proteinase K protection assay, the translation mixture was supplemented with 1 µL of 50 mM CaCl2 and 1 μl of proteinase K (2 mg/ml), and the digestion reaction was incubated for 40 min on ice47 (link),51 (link). Before SDS-PAGE analysis, the reaction was stopped by adding 1 mM phenylmethanesulfonyl fluoride (PMSF). All the translation/glycosylation experiments were repeated at least four times.
For the proteinase K protection assay, the translation mixture was supplemented with 1 µL of 50 mM CaCl2 and 1 μl of proteinase K (2 mg/ml), and the digestion reaction was incubated for 40 min on ice47 (link),51 (link). Before SDS-PAGE analysis, the reaction was stopped by adding 1 mM phenylmethanesulfonyl fluoride (PMSF). All the translation/glycosylation experiments were repeated at least four times.
7
Glycosylation Analysis of Lep Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Lep-derived constructs were assayed using the TNT T7 Quick Coupled System (#L1170, Promega). Each reaction containing 1 µL of PCR product, 0.5 µL of EasyTag™ EXPRESS 35S Protein Labeling Mix (Perkin Elmer) (5.5 µCi), and 0.3 µL of microsomes (tRNA Probes) was incubated at 30 °C for 90 min. Samples were analyzed by SDS-PAGE. The bands were quantified using a Fuji FLA-3000 phosphoimager and the Image Reader 8.1 software. Free energy was calculated using: ∆Gapp = −RT lnKapp, where Kapp = f2g/f1g being f1g and f2g the fraction of single glycosylated and double glycosylated protein, respectively. Endoglycosidase H treatment (Roche) was carried according to the specifications of the manufacturer.
8
Visualizing Tumor Permeability Using Tracers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Mice bearing established orthotopic brain tumors were administered 25 μCi of 14C-aminoisobutyrate (AIB) in 100 μl of saline, Sulforhodamine 101 (Texas Red; TxRed; 6 mg/kg) and/or 10kD Dextran–fluorescein (5 mg/kg) and after 30 minutes anesthetized with hypnorm/dormicum and subsequently perfused with saline. The brain was immediately frozen on dry ice in Tissue-Tek® (Sakura Finetek Europe BV; Alphen aan den Rijn, the Netherlands) and kept at −80°C until sectioning. 14C-AIB extravasation was visualized using autoradiography using a FLA-3000 phospho-imager (Fujifilm, Tokyo, Japan), whereas TxRed and 10kD-Dextran-lluorescein were imaged using a Axio Scan.Z1 (Carl Zeiss; Oberkochen, Germany) and subsequently processed and analyzed using ZEN Blue (v3.1; Carl Zeiss) and HALO (v3.1.10076.423; Indica Labs, Albuquerque, NM).
9
Quantitative Northern Blotting of HA-tagged mRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cultures identical to those used for western blot analysis, using a Nucleospin RNA Extraction Kit (Macherey-Nagel). 5–10 μg of total RNA were used for northern blotting using the glyoxal denaturation method (55 ). A specific probe for the detection of HA-tagged overexpressed constructs was generated by PCR amplification of the BG1805 plasmid with primers GTGGTTGATGTGTCTAGAC and GTAAGATCTCATAGAACGCG (listed 5′-3′). For normalisation of loaded and transferred RNA samples, a specific probe for the yeast SCR1 mRNA was amplified from genomic DNA using primers TCCTTCCTCGCGGCTAGA and CACCTTTGCTGACGCTGG (listed 5′-3′). PCR products were radio-labelled by random priming and RNA levels were quantified using a Fuji FLA-3000 phosphoimager.
10
EMSA with GST-SUV39H1 Binding Assay
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!