Cells were lysed in 0.5 ml of TRI Reagent (Sigma, catalog no. T9424), and total RNA was extracted according to the manufacturer’s protocol. One microgram of total RNA was retrotranscribed using SensiFAST cDNA Synthesis Kit (Bioline, London, UK, catalog no. BIO-65054). Real-time polymerase chain reaction (PCR) was performed using iTaq qPCR master mix according to the manufacturer’s instructions (Bio-Rad, Segrate, Italy, catalog no. 1725124) on a SFX96 Real-Time System (Bio-Rad). As a control, S18 ribosomal subunit was used, whose expression did not change across the conditions. For each gene, ΔCt was calculated by using the formula ΔCt = 2^(ΔCt(gene) – ΔCt(S18)). The data are expressed as a percentage variation between P3HT light and glass light conditions and P3HT dark and glass dark samples, respectively. Sequences of oligonucleotide primers are listed in table S1.
Sfx96 real time system
Manufactured by Bio-Rad
Sourced in Italy, United States
The SFX96 Real-time system is a laboratory instrument designed for real-time PCR analysis. It provides accurate and reliable data acquisition and analysis for quantitative gene expression studies.
Automatically generated - may contain errors
Lab products found in correlation
Itaq qpcr master mix, by Bio-Rad (8 mentions)
Sensifast cdna synthesis kit, by Meridian Bioscience (3 mentions)
Im prom 2 system, by Promega (2 mentions)
Trizol lysis reagent, by Thermo Fisher Scientific (2 mentions)
Absolutely rna mirna kit, by Agilent Technologies (2 mentions)
Improm 2 rt system, by Promega (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Tri reagent, by Merck Group (1 mentions)
Split rna extraction kit, by Lexogen (1 mentions)
Sensifast kit, by Meridian Bioscience (1 mentions)
8 protocols using sfx96 real time system
1
Real-time PCR Gene Expression Analysis
2
Quantification of Gene Expression Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total mRNA was extracted from 1.0 × 106 cells using TRIzol Lysis Reagent (Invitrogen, Thermo Fisher Scientific, Milan, Italy, Cat. 15596026) according to the manufacturer’s instruction. The first strand of cDNA was synthesized from 0.5–1 µg of total RNA using Im-Prom-II system (Promega, Madison, WI, USA, Cat. A3800). Real-Time PCR was performed using iTaq qPCR master mix, according to the manufacturer’s instructions (Bio-Rad, Hercules, CA, USA, Cat. 1725124), in a SFX96 real-time system (Bio-Rad, Hercules, CA, USA). To normalize raw real-time PCR data, an S18 ribosomal subunit was used. Primers used were listed in Table 3 . Data are expressed as delta-C (t) of the gene of interest to S18, allowing appreciation of single gene expression levels.
3
Quantification of mRNA Expression by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total mRNA was extracted from 0.5 × 106 cells using a SPLIT RNA Extraction Kit (Lexogen, Austria, cat# 008.48) according to the manufacturer’s instructions, as described in [34 (link)]. cDNA was synthesised from 0.5–1 µg of total RNA using a SensiFAST cDNA Synthesis Kit (BioLine, London, UK, Cat. BIO-65054). Real-Time PCR was performed using iTaq qPCR master mix according to the manufacturer’s instructions (Bio-Rad Laboratories, Hercules, CA, USA; cat# 1725124) on an SFX96 Real-Time system (Bio-Rad Laboratories). An S18 ribosomal subunit was used to normalise the raw data. The data are calculated for each sample as 2^-(Ct(GOI) − Ct(S18)) and expressed as mean ± standard deviation from three independent cultures, each run in triplicate. The primers’ sequences are provided in Table S2 .
4
Gene Expression Analysis by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total mRNA was extracted from 1.0 × 10^6 cells using TRIzol Lysis Reagent (Invitrogel, Cat. 15596026) according to manufacturer’s instruction. First strand of cDNA was synthesized from 0.5–1 µg of total RNA using Im-Prom-II system (Promega, Cat. A3800). Real-Time PCR was performed using iTaq qPCR master mix according to manufacturer’s instructions (Bio-Rad, Cat. 1725124) on a SFX96 Real-time system (Bio-Rad). To normalize raw real-time PCR data, S18 ribosomal subunit was used. Data are expressed as delta-C (t) of gene of interest to S18 allowing appreciation of single gene expression level. Oligonucleotide primers were as follows: Atf4 (NM_009716.3), forward: GTTTAGAGCTAGGCAGTGAAG, reverse: CCTTTACACATGGAGGGATTAG; Xbp1 spliced (Xbp1s, NM_001271730.1), forward: AGTCCGCAGCAGGTG, reverse: GGTCCAACTTGTCCAGAATG; Herpud1 (NM_022331.2), forward: GTGGAGGAAGATGATGAGATAAA, reverse: CTCAGCGAGGAGTAGAAGTA; S18 (NM_011296), forward: TGCGAGTACTCAACACCAACA, reverse: CTGCTTTCCTCAACACCACA.
5
Real-Time PCR Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total mRNA was extracted from 1.0 × 106 cells using TRIzol Lysis Reagent (Cat. 15596026, Invitrogen, Milan, Italy) according to manufacturer’s instruction. First strand of cDNA was synthesized from 0.5–1 µg of total RNA using SensiFast kit (BioLine, London, UK, Cat. BIO-65054). Real-Time PCR was performed using iTaq qPCR master mix according to manufacturer’s instructions (Cat. 1725124, Bio-Rad, Segrate, Italy) on a SFX96 Real-time system (Bio-Rad, Segrate Italy). To normalize raw real time PCR data, S18 ribosomal subunit was used. Primer sequences are provided in Table 1 . Data are expressed as delta-C(t) of gene of interest to S18 allowing appreciation of single gene expression level.
6
Quantitative Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from 1 × 106 cells using Absolutely RNA miRNA kit (Agilent, Santa Clara, CA) according to the manufacturer’s instructions. Total RNA (0.5–1 μg) was retro-transcribed using random hexamers and ImProm-II RT system (Promega, Milan, Italy). Real-time PCR was performed using iTaq qPCR master mix according to the manufacturer’s instructions (Bio-Rad, Segrate, Italy) on a SFX96 Real-time system (Bio-Rad). To normalize raw real-time PCR data, S18 ribosomal subunit was used. Sequences of oligonucleotide primers are provided in Supplementary Materials. The real-time PCR data are expressed as delta-C(t) of gene of interest to S18 allowing appreciation of the relative expression level of a single gene.
7
Validating RNA-Seq and Proteomic Data
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For validation of RNA-Seq and shotgun proteomic results, samples were prepared from a separate set of 12 ACN-Ctr and ACN-KO 1 month old mice.
For real-time PCR, hippocampal or cerebellar tissues were lysed in Trizol reagent (Invitrogen, Cat. 15596026). Total RNA was extracted using according to manufacturer's instructions using chloroform extraction followed by isopropanol precipitation. After washing with 75% ethanol, RNA was dried and resuspended in 20-30 μL of RNAse-free water. 0.5-1 μg of total RNA was retrotranscribed using SensiFAST cDNA Synthesis Kit (BioLine, London, UK). Real-time PCR was performed using iTaq qPCR master mix according to manufacturer's instructions (Bio-Rad, Segrate, Italy, Cat. 1725124) on a SFX96 Real-time system (Bio-Rad). To normalize raw real-time PCR data, S18 ribosomal subunit was used. Sequences of oligonucleotide primers is listed in Supplementary Methods Table 1. The real-time PCR data are expressed as delta-C(t) of gene of interest to S18 allowing appreciation of the expression level of a single gene.
For real-time PCR, hippocampal or cerebellar tissues were lysed in Trizol reagent (Invitrogen, Cat. 15596026). Total RNA was extracted using according to manufacturer's instructions using chloroform extraction followed by isopropanol precipitation. After washing with 75% ethanol, RNA was dried and resuspended in 20-30 μL of RNAse-free water. 0.5-1 μg of total RNA was retrotranscribed using SensiFAST cDNA Synthesis Kit (BioLine, London, UK). Real-time PCR was performed using iTaq qPCR master mix according to manufacturer's instructions (Bio-Rad, Segrate, Italy, Cat. 1725124) on a SFX96 Real-time system (Bio-Rad). To normalize raw real-time PCR data, S18 ribosomal subunit was used. Sequences of oligonucleotide primers is listed in Supplementary Methods Table 1. The real-time PCR data are expressed as delta-C(t) of gene of interest to S18 allowing appreciation of the expression level of a single gene.
8
RNA Extraction and Real-Time PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Tissues or cells were lysed in Trizol reagent (Invitrogen, Cat. 15596026) . Total RNA was extracted using Absolutely RNA miRNA kit (Agilent, 400809) according to manufacturer's instructions. 0.5-1 μg of total RNA was retrotranscribed using random hexamers and ImProm-II RT system (Promega, Milan, Italy, Cat. A3800). Real-time PCR was performed using iTaq qPCR master mix according to manufacturer's instructions (Bio-Rad, Segrate, Italy, Cat. 1725124) on a SFX96 Real-time system (Bio-Rad). To normalize raw real-time PCR data, S18 ribosomal subunit was used. Sequences of oligonucleotide primers is listed in Supplementary Table 1. The real-time PCR data are expressed as delta-C(t) of gene of interest to S18 allowing appreciation of the expression level of a single gene.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!