Facs jazz 2 cell sorter

The lentiviral DOX-inducible GFP-IRES-shRNA FH1tUTG construct was provided by Dr. Marco Herold^{24 (link)} and used to generate control shRNA and JMJD6 shRNA expression constructs. Control shRNA, JMJD6 shRNA-1, and JMJD6 shRNA-2 target sequences were GCACTACCAGAGCTAACTCAGATAGTACT, CGAAGCTATTACCTGGTTTAA, and ATGGACTCTGGAGCGCCTAAA, respectively. Sense and antisense control shRNA, JMJD6 shRNA-1, and JMJD6 shRNA-2 oligoes were cloned into the DOX-inducible GFP-IRES-shRNA FH1tUTG construct. The DOX-inducible GFP-IRES-control shRNA, JMJD6 shRNA-1 or JMJD6 shRNA-2 construct was transfected into 293T cells. Viral media were collected to infect CHP134 and SK-N-AS neuroblastoma cells with polybrene (Santa Cruz Biotechnology, Santa Cruz, CA) for 72 h. Cells with high GFP protein expression were selected by fluorescence-activated cell sorting with BD FACS Jazz™ II Cell Sorter (BD Biosciences, Franklin Lakes, NJ). For inducing shRNA expression in vitro, the cells were treated with 2 µg/ml DOX every 24 h.

The lentiviral construct, DOX‐inducible GFP‐shRNA FH1tUTG, was provided by M. Herold [20] and used to produce control or DDX21 short hairpin RNA (shRNA) expression constructs as described previously [21]. The control shRNA and DDX21 shRNA‐1 and DDX21 shRNA‐2 target sequences were 5′‐GCACTACCAGAGCTAACTCAGATAGTACT‐3′, 5′‐CGCTCCTTGATCAACTCAAAT‐3′, and 5′‐GGAGACACTGCGAAAGCAAAC‐3′, respectively. Forward and reverse control shRNA, DDX21 shRNA‐1, and DDX21 shRNA‐2 oligonucleotides were inserted into the DOX‐inducible GFP‐shRNA FH1tUTG vector. HEK293T cells were then transfected with these constructs, viral medium was harvested and used to transduce BE(2)‐C and Kelly neuroblastoma cells in the presence of polybrene (8 µg·mL⁻¹) (Santa Cruz Biotechnology, Santa Cruz, CA, USA) for 72 h. Cells expressing high GFP were sorted with BD FACS Jazz™ II Cell Sorter (BD Biosciences, Franklin Lakes, NJ, USA). BE(2)‐C and Kelly cells containing the shRNAs were treated with 2 µg·mL⁻¹ of DOX (Sigma) daily to activate shRNA expression in vitro.

The lentiviral doxycycline-inducible GFP-IRES-shRNA FH1tUTG construct from Dr. Marco Herold^{36 (link)} was used to generate control shRNA and lncNB1 shRNA expressing constructs as well as neuroblastoma cell lines stably expressing the constructs. lncNB1 shRNA target sequences were GCTGCAGCGTTTACCCAAAGA (shRNA-1) and GCTTCCTTCAAACCTCAAATC (shRNA-2) (Supplementary Table 6). Sense and antisense shRNA oligoes were synthesized by GeneWorks (Thebarton, SA, Australia), and cloned into the doxycycline-inducible GFP-IRES-shRNA FH1tUTG construct. The doxycycline-inducible GFP-IRES-control shRNA, lncNB1 shRNA-1, or lncNB1 shRNA-2 FH1tUTG construct was transfected into 293T cells. Viral media were collected and employed to infect neuroblastoma cells with polybrene (Santa Cruz Biotechnology, Santa Cruz, CA) for 72 h. Fluorescence-activated cell sorting was performed with BD FACS Jazz™ II Cell Sorter (BD Biosciences, Franklin Lakes, NJ) to select neuroblastoma cells with high GFP protein expression. Cells were treated with 2 µg/ml doxycycline (Sigma) or DMSO vehicle control every 24 h to or to not induce shRNA expression.