Total RNA was isolated from cervical cancer samples and cervical cancer cell lines using TRIzol™ reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. RNA concentration was determined using a UV‐visible spectrophotometer (NanoDrop™ ND‐1000). Total RNA (1 μg) was used for reverse transcription using the ReverTra Ace® qPCR RT kit (Toyobo, Osaka, Japan). qRT‐PCR was performed using the RNA‐direct™ SYBR® Green Real‐time PCR Master Mix (Toyobo). Primers for TUG1 amplification were as follows: forward: 5′‐GAACTACTGCGGAACCTCAA‐3′; reverse: 5′‐ACTTGGTGAGCACCACTCC‐3′. Glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) was used as an internal standard with forward primer: 5′‐CTGCCAACGTGTCAGTGGTG‐3′; reverse primer: 5′‐TCAGTGTAGCCCAGGATGCC‐3′. All experiments were performed in triplicate. All assays were performed using the ABI 7900HT qRT‐PCR system (Applied Biosystems, Foster City, CA). Relative expression was calculated using the 2−ΔΔCt method 25 .
Abi 7900ht qrt pcr system
Manufactured by Thermo Fisher Scientific
Sourced in Japan, United States
The ABI 7900HT qRT-PCR system is a real-time quantitative reverse transcription polymerase chain reaction (qRT-PCR) instrument. It is designed to perform sensitive and accurate gene expression analysis.
Automatically generated - may contain errors
Lab products found in correlation
Revertra ace qpcr rt kit, by Toyobo (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Rna direct sybr green realtime pcr master mix, by Toyobo (2 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (1 mentions)
Reverse transcription kit, by Takara Bio (1 mentions)
Trizol reagent, by Takara Bio (1 mentions)
Sybr green realtime pcr master mix, by Toyobo (1 mentions)
3 protocols using abi 7900ht qrt pcr system
1
Quantitative Analysis of TUG1 Expression
2
TUG1 and p53 Expression in LSCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from LSCC and normal tissue specimens using TRIzol reagent (Takara Bio, Otsu, Japan) following the manufacturer's instructions. RNA (500 ng) from each specimen was subjected to cDNA synthesis using a reverse transcription kit (RR047A; Takara Bio) immediately after its concentration was determined using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE). qRT-PCR was performed using SYBR Green Real-Time PCR Master Mix (Toyobo, Osaka, Japan) and an ABI 7900HT qRT-PCR system (Applied Biosystems, Foster City, CA). TUG1 and b-actin were amplified in triplicate at an annealing temperature of 60°C. The relative expression of TUG1 and p53 was calculated using the DDCt method [22] , and b-actin was used as an internal control. Their sequences were as follows: TUG1: forward, 5'-CTGGACCTGGAACCCGAAAG-3'; reverse, 5'-GGTAGTGCTTGCTCAGTCGT-3'; p53: forward, 5'-GCGCACAGAGGAAGAGAATC-3'; reverse, 5'-CAAGGCCTCATTCAGCTCTC-3'; and b-actin: forward, 5'-CATGTACGTTGCTATCCAGGC-3'; reverse, 5'-CTCCTTAATGTCACGCACGAT-3'.
3
Quantitative RT-PCR Analysis of HCC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from HCC samples and cell lines using TRIzol™ reagent (Invitrogen, Carlsbad, CA, USA). RNA concentration was measured by a spectrophotometer (NanoDrop™ ND-1000). Total RNA (1 μg) was reversely transcribed using the ReverTra Ace qPCR RT kit (Toyobo, Osaka, Japan). QRT-PCR was performed using RNA-direct TMSYBR® GreenReal-time PCR Master Mix (Toyobo, Osaka, Japan). The amplified primers were shown in Table 1. Relative level was measured with the ABI 7900HT qRT-PCR system (Applied Biosystems, Foster City, CA, USA) and calculated by 2 -ΔΔCt method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!