Ethanol preserved samples were stored in the Pelagic Invertebrate Collection at Scripps Institution of Oceanography for metabarcoding analyses [53 (link)]. DNA sequences were generated from the liquid ethanol pipetted off the top of 84 preserved samples as described in Gold et al. [39 ]. Briefly, up to 125 mL of ethanol (mean = 121 mL, n = 6 < 125 mL, min = 34 mL) was filtered onto 0.2 μm PVDF filters and were extracted using a Qiagen DNeasy Blood and Tissue kit. We then amplified three technical PCR replicates using a touchdown PCR and the MiFish Universal Teleost specific primer [54 (link)]. Both a negative control (molecular grade water instead of DNA extract) and two positive controls (DNA extract from non-native, non-target species) were included alongside samples. Libraries were prepared using Illumina Nextera indices following the methods of Curd et al. [55 (link)] and sequenced on a NextSeq 2x 150 bp mid output. Sequencing data was then processed using the Anacapa Toolkit [55 (link)] to conduct quality control, ASV dereplication, and taxonomic assignment. Sequences were annotated with the California fish specific reference database and a bootstrap confidence cutoff score of 60 following the methods of Gold et al. [56 (link)]. Eight technical replicates with either low sequencing depth (n<30,000) or high dissimilarity (Bray Curtis dissimilarity > 0.7) were removed.
Nextera indices
Manufactured by Illumina
Sourced in United States
Nextera indices are oligonucleotide sequences designed for use with Illumina's Nextera library preparation kits. They enable multiplexed sequencing by providing unique molecular identifiers that are added during the library preparation process.
Automatically generated - may contain errors
Lab products found in correlation
Miseq instrument, by Illumina (2 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Minelute pcr purification kit, by Qiagen (2 mentions)
Dneasy blood and tissue kit, by Qiagen (1 mentions)
Nextera xt dna library preparation kit, by Illumina (1 mentions)
Miseq control software, by Illumina (1 mentions)
Dneasy blood tissue kit, by Qiagen (1 mentions)
Ampure xp bead, by Beckman Coulter (1 mentions)
Qubit dsdna br, by Thermo Fisher Scientific (1 mentions)
Miseq reagent micro kit v2, by Illumina (1 mentions)
Phix spike in, by Illumina (1 mentions)
Bcl2fastq, by Illumina (1 mentions)
Qubit hs dna kit, by Thermo Fisher Scientific (1 mentions)
Powersoil kit, by Qiagen (1 mentions)
Kapa library quantification kit, by Qiagen (1 mentions)
Nextseq, by Illumina (1 mentions)
6 protocols using nextera indices
1
Metabarcoding of Preserved Marine Invertebrates
2
Nextera XT DNA Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA sequencing libraries were prepared with the Nextera XT DNA library preparation kit and Nextera indices (Illumina, San Diego, CA). Libraries were sequenced on a MiSeq platform using a MiSeq 500 cycle version 2 reagent kit (Illumina).
3
BCMA and CS1 Loci Amplicon Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from 1 × 106 tumor cells using DNeasy Blood & Tissue Kit (Qiagen). BCMA and CS1 loci amplicons, with Nextera transposase adapters (Illumina) flanking each target locus, were prepared via PCR with the isolated genomic DNA. Nextera indices (Illumina) were attached to the adapters to barcode each amplicon samples via PCR. After each PCR round, amplicons were purified using AMPure XP beads (Beckman Coulter). The barcoded amplicon samples were then sent to the UCLA Technology Center for Genomics & Bioinformatics for multiplex sequencing with 2 × 300 paired-end configuration in a single-lane flow cell of MiSeq instrument (Illumina), and data were collected using MiSeq Control Software version 2.6.2.1 (Illumina). Fastq paired-end raw data were filtered, trimmed, and merged with DADA2 (version 1.12) on R 3.5.0 software. This work used computational and storage services associated with the Hoffman2 Shared Cluster provided by UCLA Institute for Digital Research and Education’s Research Technology Group.
4
CRISPR Screening of Hematopoietic Stem Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from HSPCs using Quick extraction buffer. The targeted amplicons library was prepared following Illumina’s recommendation using a two-step PCR protocol. Briefly, nested PCRs were performed on each DNA sample using the HiFi KAPA polymerase (Roche). Following Illumina barcoding (Nextera indices; Illumina), PCR samples were pooled, beads were purified and quantified using Qubit dsDNA BR (Thermo Fisher Scientific). The library was sequenced on an Illumina MiSeq instrument using Illumina MiSeq Reagent Kit v2 Micro (300 cycles) with 50% PhiX spike-in (Illumina). After demultiplexing, each sample was assessed for quality and analyzed using CRISPResso v2 (Clement et al., 2019 (link)). For each of the samples, we provided the HDRT, the reference sequence, and the guide sequence, and applied a minimum base quality of Phred 25. We used a custom R script to quantify each allele within a quantification window of four nucleotides including one silent mutation followed by the targeted amino acid.
5
Microbial Community Profiling of Soil Layers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from samples collected at 0, 12, 24, 36, 48, and 72 h from the bottom, middle, and top layers using the Power Soil Kit (Qiagen, Carlsbad, CA, USA). DNA was quantified with a Nanodrop spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The variable regions V3-V4 of the 16S rRNA gene of bacteria were amplified from the extracted total DNA using the primers 341F (TCGTCGGCAGCGTCAGATGTGTATAAGACAGAGCCTACGGGNGGCWGCAG), and 805R (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGG-TATCTAATCC), while for amplification of the ITS region of the fungi, primers 3F (TCGTCGGCAGCGTCAGATGTGTATAAGACAGGCATCGATGAAGAAC-GCAGC) and 805R (GTCTCGTGGCTCGGAGATGTGTATAAGACAG-TCCTCCGCTTATTGATGC) were used, and both were barcoded with Nextera indices, according to the manufacturer’s instructions (Illumina Inc., San Diego, CA, USA). The amplicons were quantified with the Qubit DNA HS kit (Thermo) and sequenced with the MiSeq Reagent 500 v2 kit (Illumina), in paired 2 x250 b. The fastq files were filtered and demultiplexed with bcl2fastq (Illumina). Taxonomic identification was performed with QIIME2 software package, version 1.9.0. Shannon, Simpson, and Chao indices were calculated and used to determine the alpha and beta diversity of the microbial communities.
6
Single-cell ATAC-seq Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were sorted directly into 20 μL of cold tagmentation buffer (10 μL TD, 2 μL 2% IGEPAL CA-630, 6 μL nuclease-free H2O, 2 μL TDE1 per sample), followed by incubation at 37 °C for 30 min with shaking at 500 RPM. Samples were stored at −20 °C until further processing. DNA was extracted with the QIAGEN MinElute PCR purification kit according to the manufacturer’s protocol, and samples were amplified with KAPA HiFi kits and Illumina Nextera indices. The amplified material was cleaned with the QIAGEN MinElute PCR purification kit and quantified using KAPA library quantification kits. Samples were normalized and pooled for sequencing on the NextSeq (Illumina).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!