Phusion dna polymerase kit

Blood stage, sporozoite, schizont and hypnozoite RNA samples were reverse transcribed using the High Capacity RNA-to-cDNA Kit (#4368814, Thermo Scientific, Waltham, MA, USA). The etramp gene (PcyM_0533600) was amplified in all the samples using the Phusion DNA Polymerase kit (#F530, Thermo Scientific) with the following primers: ACTCCTTGGTGGTGCCTTAG (FWD); TGCGGGGCCCTTATCTTT (REV). The Ovation Low complexity Sequencing System kit (#9092–256, NuGEN, San Carlos, CA, USA) was used to prepare the sequencing libraries. Libraries were multiplexed and sequenced in paired-end mode, at a read length of 2 × 300 bp, using the MiSeq platform (Illumina). The resulting FASTQ files were demultiplexed and aligned against the P. cynomolgi M strain genome (Pcynom M_v2, unpublished) using STAR version 2.5.2a (Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S and Dobin et al., 2013 (link)) for the detection of the amplified regions. The Integrative Genomics Viewer (IGV) (James T. Robinson, Helga Thorvaldsdóttir, Wendy Winckler, Mitchell Robinson et al., 2011 (link)) version 2.3.75 was used to visualize the aligned reads in the genome context. The etramp gene view presented in Figure 2D was generated using the R/Bioconductor GViz package (Hahne and Ivanek, 2016 (link)).

In order to generate short DNA amplicons (<300 bp), which are normally eliminated from sequencing libraries, an in-house library procedure was performed in the absence of DNA template. An in-house-designed double-stranded Y-shaped adaptor (Fig. S1) with a single thymine base extension (50 pmol) was treated with the Klenow fragment of Escherichia coli DNA polymerase I (conferring 3′→5′ exonuclease activity) (New England Biolabs; NEB, MA, USA) in the presence of dATP, followed by self-ligation using T4 DNA ligase (NEB). The ligated products were purified with Lambda Exonuclease and Exonuclease I (NEB), and then subjected to PCR amplification for 32 cycles with the Phusion DNA polymerase kit (Thermo Fisher Scientific, MA, USA) and in-house library preparation primers containing sequencing indexes. PCR amplification was also performed using the DNA standard 3, primer mix and qPCR master mix of the KAPA Library Quantification Kit Illumina Platforms (Kapa Biosystems, MA, USA), to generate amplicons of 452 bp in length. Sample mixtures (total volume: 20 µl), containing the short DNA or KAPA fragments, 1× PCR buffer, and SYBR Green I (Thermo Fisher Scientific), were prepared for the MC assay.