First strand cdna synthesis rt pcr kit

RNA was extracted from three different plates of HEK293T cells untransfected or transfected with pIRES2-GFP-piezo1a or pIRES2-GFP-piezo1b using Trizol/chloroform. cDNA was obtained after reverse transcription using a First strand cDNA synthesis RT-PCR kit (Roche), and quantitative PCR was performed using SYBR Green (Roche) and a LightCycler 480 system (Roche). The primer sequences used are as follows:
GAPDH Forward: 5′ TGCACCACCAACTGCTTAGC 3′
GAPDH Reverse: 5′ GGCATGGACTGTGGTCATGA 3′
piezo1a Forward: 5′ ATGACATAGGGCCCAGTGGA 3′
piezo1a Reverse: 5′ TGTCAGCCAGCTGTGATACG 3′
piezo1b Forward: 5′ CACCGGTGCTGATAGAGCAA 3′
piezo1b Reverse: 5′ CCTCACTGCTGTTAGCGGAA 3′

Quantitative RT-PCR was performed for the relative quantification of gene expression in the lungs of non-infected and infected mice on the 7^th dpi. RNA extraction was performed according to the "Animal Cell I" protocol from the RNeasy Mini kit (Qiagen, USA). cDNA synthesis was performed with a 1 μg RNA sample using the First Strand cDNA Synthesis RT-PCR kit (Roche, USA) according to manufacturer's instructions. Finally, for gene expression, SYBR Green PCR Master Mix (Applied Biosystems, USA) and the 2^(-ΔΔCT) relative quantification method were used as described previously [58 (link)]. The qRT-PCR reactions were performed in a 7500 Fast system (Applied Biosystems, USA) with the following oligonucleotides: Ncf2 (forward—5’ gcagtggcctacttccagag 3’; reverse- cttcatgttggttgccaatg) and HPRT (forward—5’ aagcttgctggtgaaaagga 3’; reverse- 5’ ttgcgctcatcttaggcttt 3’).