Primescript rt polymerase
PrimeScript RT-polymerase is a reverse transcriptase enzyme used for cDNA synthesis from RNA templates. It possesses RNA-dependent DNA polymerase activity and RNase H activity.
Lab products found in correlation
19 protocols using primescript rt polymerase
Quantitative Analysis of mRNA Expression
Differential Expression of E2Fs in Endometrial Cancer
Total RNA of EC tissues and normal endometrial tissues were extracted with TRIzol reagent (Vazyme, Nanjing, China). The synthesis of cDNAs corresponding to the mRNAs of interest depended on PrimeScript RT-polymerase (Vazyme). SYBR-Green Premix (Vazyme) with specific PCR primers (Sangon Biotech Co., Ltd., Shanghai, China). Glyceraldehyde-3-phosphate dehydrogenase was used as an internal control. The 2-ΔΔCt method was used to calculate fold-changes. Primer sequences are shown in
Prognostic Role of CASP8 in BLCA
BCL2 Expression in Breast Cancer
The total RNA of breast cancer tissues and normal tissues was extracted with the TRIzol reagent (Vazyme, Nanjing, China). The synthesis of cDNAs corresponding to the mRNAs of interest depended on PrimeScript RT-polymerase (Vazyme) and SYBR-Green Premix (Vazyme) with specific PCR primers (Sangon Biotech Co., Ltd, Shanghai, China). The specific primers used were as follows: GAPDH-F: GGGAAGGTGAAGGTCGGAGT; GAPDH-R: GGGGTCATTGATGGCAACA; BCL2-F: ACTGGCTCTGTCTGAGTAAG; BCL2-R: CCTGATGCTCTGGGTAAC. The fold-changes were calculated with the 2−ΔΔCt method. The difference in BCL2 expression and the prognosis of BCL2 in breast cancer were evaluated with Student’s t-test and the Kaplan–Meier analysis in GraphPad Prism 7 software (GraphPad, Inc., La Jolla, CA, United States).
Quantifying Gene Expression via RT-qPCR
PIK3CB Expression in Kidney Cancer
Quantifying Gene Expression in HCC
Quantitative RT-PCR for Gene Expression
Protein and Gene Expression Analysis
Breast Cancer ACE2 Expression Analysis
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!