Accupower cyclescript rt premix dt20

Total RNA was isolated using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions and used as a template to synthesise complementary DNA (cDNA) using Accupower cyclescript RT premix dT20 (#K-2044-B, Bioneer, Daejeon, Korea). The levels of mRNA were quantified by RT-qPCR (ABI Prism 7900) using power SYBR^® Green PCR Master Mix (Applied Biosystems). In case of miR-17-5p, miRNA-specific TaqMan primer (#4427975, ID: 000393, Applied Biosystems) was used for RT-qPCR. VIM primer (#1: F: CCCTCACCTGTGAAGTGGAT R: GCTTCAACGGCAAAGTTCTC, #2: F: CGAAAACACCCTGCAATCTT R: ATTCCACTTTGCGTTCAAGG) and GAPDH primer (F: TGCACCACCAACTGCTTAGC R: GGCATGGACTGTGGTCATGAG) were used for RT-qPCR.

Total RNAs were extracted from 2D- and 3D-cultered hADSCs using TRIzol™ reagent (catalog number: 15596026, Thermo Fisher Scientific, Waltham, MA, USA). In the 2D culture condition, cultured cells were washed with DPBS to remove extra proteins from FBS and trypsinized with TrypLE™ Express (catalog number: 12605036, Thermo Fisher Scientific, Waltham, MA, USA) at 37 °C for 3 min. To neutralize TrypLE™ Express, the cells were resuspended in growth media and centrifuged at 1000× g rpm for 3 min. After removing the supernatant, Trizol reagent was added to each sample. In the case of 3D spheroids, the cultured spheroids were frozen with liquid nitrogen and Trizol reagent was added after crushing the frozen samples. After measuring the concentration of extracted RNA using NanoDrop™ 2000 (Thermo Fisher Scientific, Waltham, MA, USA), cDNA was synthesized with AccuPower^® CycleScript RT PreMix, dT20 (catalog number: K-2044, Bioneer, Daejoen, Korea). Analysis of mRNA expression was carried out using an AccuPower^® 2X Greenstar qPCR Master Mix (catalog number: K-6253, Bioneer) with Rotor-Gene Q (Qiazen, Hilden, Germany) by following the manufacture’s protocols. The primers for qRT–PCR were designed with primer 3; the primer sequences are listed in Table S2.