7500 rt pcr system

Total RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the specification, and 1 μg RNA was then reversely transcribed to cDNA with Hifair™ 1st Strand cDNA Synthesis Kit (Yeasen, Shanghai, China, Cat# 11123ES10). Quantitative real‐time PCR was performed with Hifair™ qPCR SYBR Green Master Mix (Yeasen, Cat# 11201ES08). qRT‐PCR was performed by a 7500 RT‐PCR system (Thermo Fisher Scientific, Waltham, MA, USA), and the annealing temperature was 55°C. GAPDH served as a normalizing control. The qPCR primers for DNAH17, forward primer, 5′‐TTACACCAACGTCACTGAAGGG‐3′ and reverse primer, 5′‐AGTCGGCTTGTTCCATCTCCT‐3′; for GAPDH, forward primer, 5′‐GTGAAGCAGGCGTCGGA‐3′ and reverse primer, 5′‐AGCCCCAGCGTCAAAGG‐3′. The range of the obtained Ct values was 15‐30. Each sample was tested in triplicate. The 2^−ΔΔCT as a calculation method was performed to analyze the expression of DNAH17 gene in the selected cell lines after decitabine treatment.

DNA synthesis was performed by using SuperScript IV VILO Master Mix (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's protocol. The qPCR by the cycles of single-stranding (15 s at 95 °C), primer annealing (1 min at 60 °C), and amplification with Taq DNA polymerase (1 min at 72 °C) was run on Applied Biosystem's 7500 RT-PCR System. Used primers were as follows: Ppargc1 (Mm01208835_m1), Gapdh (Mm99999915_g1), PPARGC1 (Hs00173304_m1), GAPDH (Hs02786624_g1). We chose Gapdh or GAPDH as housekeeping control to normalize the cycle threshold (CT) values of the target transcript calculated by the ΔΔCT method.

RT-PCR analysis was carried out in triplicate using Taqman advanced master mix using the 7,500 RT-PCR system (Applied biosystem Foster City, CA). DMT1-specific primers (GenBank accession number EF635922) and β-actin (GenBank accession number L08165) were purchased from Thermo Fisher Scientific (Grand Island, NY). The sequences of primer for DMT1 were as follows: forward 5′-AGCCGTTCACCACTTATTTCG-3′, reverse 5′-GGTCCAAATAGGCGATGCTC-3′, and primers pair for β -actin—forward 5′-GAGAAATTGTGCGTGACATCA-3′, reverse 5′-CCTGAACCTCTCATTGCCA-3′. A 5 μl cDNA sample was diluted (1:25) with DNase-free water and mixed with a working reagent that contained 10 μl Taqman enzyme, 1 μl specific PCR primers, and 4 μl nuclease free water. The RT-PCR reaction conditions consisted of 50°C for 2 min; 95°C for 20 s; 40 cycles of 95°C for 3 s; and 60°C for 30 s. In each run, a non-template control was used to check for genomic contamination. Expression of DMT1 in each sample was normalized to β-actin and the relative quantification was expressed as a fold change of the target gene using 2^−ΔΔCT.

The International HapMap Project SNP database, based on the NCBI B36 assembly Data Rel 28. phase II + III, build 126, was used to identified FFAR4 tagged SNPs [42 (link)]. We added 500-kilo base pairs downstream of FFAR4 and 2500-kilo base pairs upstream to cover the 5’UTR and 3’UTR regions. Gene Tagger procedure in Haploview V4.2 was used to determine FFAR4 tagged SNPs using a pairwise tagging (r² ≥ 0.8) and a minor allele frequency ≥5%. Subsequently, we used the LD Plot procedure in Haploview V4.2 to examine the linkage disequilibrium out of the twelve FFAR4 SNPs (Figure 3). Genomic DNA was prepared using the SIGMA GenElute Gel Extraction Kit (Sigma-Aldrich Co. St. Louis, MO, USA). FFAR4 tagged SNPs (rs17484310, rs11187515, rs1414929, rs12415204, rs12219199, rs2065875, rs7081686, rs11187527, rs11187529, rs11187534, rs11187537, rs17108973) have been genotyped in 210 individuals using validated primers and TaqMan probes (Life Technologies Corporation, Burlington, ON, Canada) [43 (link)]. DNA was mixed with TaqMan Universal PCR Master Mix (Life Technologies Corporation), with a gene-specific primer and with probe mixture in a final volume of 10 μL (predeveloped TaqMan SNP Genotyping Assays). Genotypes were determined and analyzed using a 7500 RT-PCR System and ABI Prism SDS version 2.0.5 (Life Technologies Corporation).