H3k4me3 antibody

Manufactured by Merck Group

Sourced in Morocco, United States

The H3K4me3 antibody is a laboratory reagent used in experimental applications to detect and quantify the trimethylation of lysine 4 on histone H3 protein. This histone modification is associated with active gene transcription and is widely studied in the field of epigenetics.

Automatically generated - may contain errors

Lab products found in correlation

Dynabead, by Thermo Fisher Scientific (2 mentions) H3k27ac antibody, by Abcam (2 mentions) Monoclonal anti gapdh peroxidase clone gapdh 71, by Merck Group (2 mentions) H3k27ac antibody, by Diagenode (2 mentions) Alexa fluor 647 a 21244, by Thermo Fisher Scientific (2 mentions) H3k27ac ab4279, by Abcam (2 mentions) Pab 196 050, by Diagenode (2 mentions) Bioruptor, by Diagenode (2 mentions) Bioruptor pico, by Diagenode (1 mentions) Dynabeads protein a, by Merck Group (1 mentions) Dynabeads protein a, by Thermo Fisher Scientific (1 mentions) H3k27me3 antibody, by Merck Group (1 mentions) Truseq chip sample preparation kit, by Illumina (1 mentions) Histone 3, by Abcam (1 mentions) Paraformaldehyde (pfa), by Thermo Fisher Scientific (1 mentions) Thruplex dna seq kit, by Takara Bio (1 mentions) Bioruptor pico sonication system, by Diagenode (1 mentions) Hiseq 2500 sequencer, by Illumina (1 mentions) Solexa 1g genome analyzer, by Illumina (1 mentions) Solexa adaptors, by Illumina (1 mentions)

Close spelling variants of this product

Anti-H3K4me3 antibody H3K4me3

19 protocols using h3k4me3 antibody

Chromatin Immunoprecipitation with H3K4me3

Check if the same lab product or an alternative is used in the 5 most similar protocols

In performing ChIP, cells were crosslinked with 1% formaldehyde, lysed, and sonicated using a Bioruptor Pico (Diagenode) to generate chromatin fragments < 500 bp. For each ChIP, 20–30 μg of sonicated chromatin was used and immunoprecipitated using an H3K4me3 antibody (Millipore 04-745), on magnetic Dynabeads (Invitrogen). For spike-in normalized ChIP-qPCR, 5 μg of sonicated Drosophila chromatin was added to each ChIP sample prior to immunoprecipitation. qPCR enrichment was normalized to Drosophila values across all samples. Primers are listed (5ʹ-to-3ʹ) as follows:

COBL forward	AAGGACGCCTGCATACAAAC
COBL reverse	GTAGTGGTGGAGCAGGTGGT
ZEB2 forward	AGTTTTGGCCAGAAATGGTG
ZEB2 reverse	GAGTGGCCGAAAGAGATCAG
ZEB2-2 forward	CCCTTTCCTTCGAAAAGTCC
ZEB2-2 reverse	TTGTTTCCTCTGGGAATTGG

Lewis N.A., Klein R.H., Kelly C., Yee J, & Knoepfler P.S. (2022). Histone H3.3 K27M chromatin functions implicate a network of neurodevelopmental factors including ASCL1 and NEUROD1 in DIPG. Epigenetics & Chromatin, 15, 18.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation of Histone Marks

Check if the same lab product or an alternative is used in the 5 most similar protocols

Neuro 2a cells were grown to confluency on 150-mm culture dishes. Cells were crosslinked directly on the dishes for 10 min at room temperature with 1% formaldehyde, followed by quenching with 0.125 M glycine for 5 min. Cells were scraped, pelleted, and lysed in cell lysis buffer for 10 min on ice. Nuclei were collected and lysed in 10 mM Tris (pH 8.0), 1% SDS, 1 mM EDTA, and 1 mM EGTA. DNA shearing was performed on a Bioruptor instrument. Chromatin was precleared with Protein A Dynabeads (Invitrogen) for 2 h, and an aliquot was saved as input. Immunoprecipitation was performed using 32 µL Protein A Dynabeads and 5 µL of H3K4me3 antibody (Millipore; 07-473) or 10 µg H3K27ac antibody (Abcam; ab4729). Chromatin was eluted with elution buffer and reverse crosslinked overnight at 65°C, followed by treatment with RNase A for 30 min at 42°C and proteinase K for 3 h at 55°C. DNA was extracted twice with phenol/chloroform and once with chloroform and ethanol precipitated; 10 ng of ChIP DNA was used for library preparation.

Zhao Y.T., Kwon D.Y., Johnson B.S., Fasolino M., Lamonica J.M., Kim Y.J., Zhao B.S., He C., Vahedi G., Kim T.H, & Zhou Z. (2018). Long genes linked to autism spectrum disorders harbor broad enhancer-like chromatin domains. Genome Research, 28(7), 933-942.

+ Open protocol

+ Expand

Chromatin Immunoprecipitation Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Detailed method is provided in Supplementary Methods. For immunoprecipitation, Oct4 antibody (Cell Signaling, 5677S) and SRF antibody (Active Motif, 61385, Santa Cruz, sc-335) were used at 6 μg/ChIP sample, H3K4me3 antibody (Millipore, 07-473), H3K27ac antibody (Abcam, Ab4729), and H3K27me3 antibody (Millipore, 07-449) were used at 1 μg/ChIP sample.

Hu X., Liu Z.Z., Chen X., Schulz V.P., Kumar A., Hartman A.A., Weinstein J., Johnston J.F., Rodriguez E.C., Eastman A.E., Cheng J., Min L., Zhong M., Carroll C., Gallagher P.G., Lu J., Schwartz M., King M.C., Krause D.S, & Guo S. (2019). MKL1-actin pathway restricts chromatin accessibility and prevents mature pluripotency activation. Nature Communications, 10, 1695.

+ Open protocol

+ Expand

Antibody Reagents for Signal Transduction

Check if the same lab product or an alternative is used in the 5 most similar protocols

Rabbit antibodies against TrkA (14G6) (#2508), phospho-TrkA (Tyr674/675)/TrkB (Tyr706/707) (#C50F3); phospho-p44/42 MAPK (ERK1/2) (Thr202/Tyr204) (#9101), p44/42 MAPK (ERK1/2) (137F5) (#4695); phospho-STAT6 (Tyr641) (C11A12); EGR1 (44D5) (#4154); EGR3 (#2559), p38 MAPK (D13E1) XP® (#8690); mouse monoclonal antibody against p44/42 MAPK (Erk1/2) (3A7, #9107) and anti-rabbit IgG, HRP-linked (#7074) were purchased from Cell Signaling (Cell Signaling Technology, MA). STAT6 (S-20, sc-621) was from Santa Cruz (Santa Cruz Biotechnology, TX). Monoclonal anti-GAPDH-peroxidase clone GAPDH-71.1 (#G9295) was from Sigma (Sigma-Aldrich Corp. St. Louis, MO). For chromatin immune precipitation (ChIP) H3K4me3 (ab8580), H3K9Ac (ab10812) and H3K27Ac (ab4279) were from Abcam (Abcam, Cambridge, MA). Some ChIP experiments were performed with H3K27Ac antibody from Diagenode (pAb-196-050, Diagenode Inc., Denville, NJ) and H3K4me3 antibody from Millipore (17–614, Billerica, MA). For immunofluorescence goat antrabbit Alexa Fluor 647 (A-21244) and goat ant-mouse Alexa Fluor 488 (A11029) were from Invitrogen (Invitrogen, Carlsbad, CA).

Rochman M., Kartashov A.V., Caldwell J.M., Collins M.H., Stucke E.M., Kc K., Sherrill J.D., Herren J., Barski A, & Rothenberg M.E. (2014). Neurotrophic tyrosine kinase receptor 1 is a direct transcriptional and epigenetic target of IL-13 involved in allergic inflammation. Mucosal immunology, 8(4), 785-798.

+ Open protocol

+ Expand

ChIP-seq of H3K4me3 in Schistosoma

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Two biological replicates of male cercaria (2× 10,000 individuals) and immature worms (2× 20 individuals) were respectively obtained by monoclonal infection of Biomphalaria glabrata followed by unisex infection of Swiss OF1 mice (Picard et al. 2016 (link) for details). Native chromatin immunoprecipitation assay was done according to Cosseau et al. (2009) (link) using 4 µl of H3K4me3 antibody (Millipore, cat. number 04-745, lot number NG1680351). Further details are available at http://methdb.univ-perp.fr/epievo/; Last accessed June 27, 2019. ChIP library construction and sequencing were performed at the sequencing facilities of Montpellier GenomiX (MGX, France). Briefly, TruSeq ChIP sample preparation kit (Illumina Inc., USA) was used according to the manufacturer’s recommendations on 30 ng of DNA per condition. DNAs were blunt ended and adenylated on 3′ ends. Illumina’s indexed adapters were ligated to both ends, and resulting ligated DNA were enriched by polymerase chain reaction (PCR). PCR products were separated by size using electrophoresis and 400 base pairs (bp) fragments were selected. The quantitative analysis of the DNA library was carried on Agilent High Sensitivity chip and qPCR (Applied Biosystems 7500, SYBR Green). Finally, the sequencing was performed on a HiSeq2500 in single-read 50-nt mode.

Picard M.A., Vicoso B., Roquis D., Bulla I., Augusto R.C., Arancibia N., Grunau C., Boissier J, & Cosseau C. (2019). Dosage Compensation throughout the Schistosoma mansoni Lifecycle: Specific Chromatin Landscape of the Z Chromosome. Genome Biology and Evolution, 11(7), 1909-1922.

+ Open protocol

+ Expand

Nuclear Protein Isolation and Immunoprecipitation

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Nuclear protein isolation was done following a published protocol
[76 (link)]. Please refer to Additional file
7 for details. Immunoprecipitation was performed following a standard protocol with H3K4me3 antibody from Millipore, Billerica, MA, USA. Either nuclear protein or immunoprecipitated proteins were used for western blotting as described previously
[76 (link)]. Antibodies used in this experiment were A2BP1 (1:500; Abcam) and histone 3 (1:1,000; Abcam).

Feng J., Wilkinson M., Liu X., Purushothaman I., Ferguson D., Vialou V., Maze I., Shao N., Kennedy P., Koo J., Dias C., Laitman B., Stockman V., LaPlant Q., Cahill M.E., Nestler E.J, & Shen L. (2014). Chronic cocaine-regulated epigenomic changes in mouse nucleus accumbens. Genome Biology, 15(4), R65.

+ Open protocol

+ Expand

ChIP-seq analysis of H3K4me3 in plasma cells

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

As a complementary approach to identify variants located in genomic regions with regulatory activity in plasma cells, we analyzed previously published^{31 (link)} chromatin immunoprecipitation sequencing (ChIP-seq) data for the H3K4me3 histone modification^{38 (link)}. Briefly, L363 cells (DSMZ) were cross-linked with 1% paraformaldehyde (ThermoFisher, #28908). DNA was sonicated into 200–400 bp fragments (Bioruptor Pico Sonication System, Diagenode, Belgium). For pull-down, we used 1–10 μg of H3K4me3 antibody (Millipore, #04-745). Fragments were de-cross-linked and purified (Zymogen, #D5205). ChIP-seq libraries were prepared using the ThruPLEX DNA-seq Kit (Rubicon Genomics, #R400406) and sequenced on Illumina HiSeq 2500 sequencer (paired-end; 2 × 125 cycles). De-multiplexing and generation of FASTQ files was performed using bcl2fastq v.1.8. FastQC (v0.11.5)^{39 (link)} was used to assess read quality low-quality bases were removed using Trimmomatic (v.0.36)^{40 (link),41 (link)} prior to alignment. using Bowtie2 (v.2.3.0)^{41 (link)}. Coverage in 50 bp over the SOHL2 region was calculated with the GenomicAlignments and GenomicRanges R-packages⁴² (coverage and binnedAverage functions) and scaled to Counts-per-million (CPM) relative to the total number of reads per library.

Duran-Lozano L., Thorleifsson G., Lopez de Lapuente Portilla A., Niroula A., Went M., Thodberg M., Pertesi M., Ajore R., Cafaro C., Olason P.I., Stefansdottir L., Bragi Walters G., Halldorsson G.H., Turesson I., Kaiser M.F., Weinhold N., Abildgaard N., Andersen N.F., Mellqvist U.H., Waage A., Juul-Vangsted A., Thorsteinsdottir U., Hansson M., Houlston R., Rafnar T., Stefansson K, & Nilsson B. (2021). Germline variants at SOHLH2 influence multiple myeloma risk. Blood Cancer Journal, 11(4), 76.

+ Open protocol

+ Expand

Mapping Histone Modification in Meat Tenderness

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

LD samples from 4 tender and 5 tough were chopped into pieces in cold 1×PBS, and then crosslinked and sonicated as described previously [17 (link)]. Briefly, after chromatin was prepared for all 9 samples, equal aliquots of chromatin from each individual were pooled to create tender or tough chromatins. Thirty microgram tender or tough chromatins were digested with Micrococcal Nuclease to produce mono-nucleosomes. Then chromatin was immunoprecipitated with H3K4me3 antibody (Millipore) and purified to obtain immunoprecipitated DNA. After checked the quality by PCR, the IP-DNA was end-repaired, added A and ligated with a pair of Solexa adaptors (Illumina, San Diego, CA). After performed PCR on the DNA using the adaptor primers, fragments with a length of approximately 200–400 bp (mononucleosome + adaptors) were isolated from the agarose gel. Sequencing analysis using the purified DNA was performed on the Solexa 1G Genome Analyzer (Illumina) following the manufacturer’s protocols. The data is available at NCBI Gene Expression Omnibus (GEO) (accession number: GSE61936).

Zhao C., Carrillo J.A., Tian F., Zan L., Updike S.M., Zhao K., Zhan F, & Song J. (2015). Genome-Wide H3K4me3 Analysis in Angus Cattle with Divergent Tenderness. PLoS ONE, 10(6), e0115358.

+ Open protocol

+ Expand

CUT&RUN Profiling of Histone Marks in Hematopoietic Stem Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

CUT&RUN experiments were carried out as described (Skene et al., 2018 (link)) with modifications. Briefly, nuclei from 1x10⁵ E14.5 FL LSK cells were isolated with NE buffer (20 mM HEPES-KOH, pH 7.9, 10 mM KCl, 0.5 mM Spermidine, 0.1% Triton X-100, 20% Glycerol and 1x protease inhibitor cocktails from Roche), captured with Bio-Mag Plus Concanavalin A coated beads (Polysciences) and incubated with primary antibody for 2 hours at 4°C. After washing away unbound antibody with wash buffer (20 mM HEPES-NaOH pH 7.5, 150 mM NaCl, 0.5 mM Spermidine and 1x protease inhibitor cocktails from Roche), protein A-MNase was added to a final concentration of 700 ng/ml and incubated for 1 hour at 4 °C. The nuclei were washed again and placed in a metal block at 0°C. To activate protein A-MNase, CaCl₂ was added to a final concentration of 2 mM. The reaction was carried out for 45 min and stopped by addition of an equal volume of 2XSTOP buffer (200 mM NaCl, 20 mM EDTA, 4 mM EGTA, 50 mg/mL RNase A and 40 mg/mL glycogen). The protein-DNA complex was released by incubation for 10 min at 37 °C and centrifugation. DNA was extracted by QIAGEN PCR MinElute Kit, followed by Qubit fluorometer. Protein A-MNase (batch 6) was kindly provided by Dr. Steve Henikoff. The antibodies used were: H3K4me3 antibody, Cat #39159, Active motif; Normal rabbit IgG, Cat #12-370, Millipore.

Gao Y., Vasic R., Song Y., Teng R., Liu C., Gbyli R., Biancon G., Nelakanti R., Lobben K., Kudo E., Liu W., Ardasheva A., Fu X., Wang X., Joshi P., Lee V., Dura B., Viero G., Iwasaki A., Fan R., Xiao A., Flavell R.A., Li H.B., Tebaldi T, & Halene S. (2020). m6A Modification Prevents Formation of Endogenous Double-Stranded RNAs and Deleterious Innate Immune Responses during Hematopoietic Development. Immunity, 52(6), 1007-1021.e8.

+ Open protocol

+ Expand

ChIP-Seq Protocol for Histone Modification Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The regular ChIP-Seq experiment was performed as reported^{16 (link)} with minor modifications. Young leaves were crosslinked using 1% formaldehyde and quenched with glycine. To isolate the nuclei or chromatin, approximately 1 g of young leaves were ground in liquid nitrogen into fine powder and resuspended in 30 ml of EB1 buffer. The mixture was filtered through Miracloth, and the filtrate was centrifuged at 1800 × g for 10 min at 4 °C. The pellet was washed three times in 1.5 ml of EB2 buffer and centrifuged at 2000 × g for 10 min at 4 °C. Next, the pellet was washed in 0.5 ml of EB3 buffer and centrifuged at 2000 × g for 1 h at 4 °C. The final pellet was resuspended in 0.25 ml of NLB buffer, and the chromatin was fragmented into 200–600 bp by sonication in a Bioruptor (Diagenode). The chromatin sample was then centrifuged at 2000 × g for 10 min at 4 °C, and the supernatant was used for IP. ChIP was performed using H3K4me3 antibody (Millipore, 07-473). The remaining steps, including washing the bead-IP complexes, ChIP DNA purification, library preparation, and DNA sequencing, were the same as described for eChIP-Seq.

Zhao L., Xie L., Zhang Q., Ouyang W., Deng L., Guan P., Ma M., Li Y., Zhang Y., Xiao Q., Zhang J., Li H., Wang S., Man J., Cao Z., Zhang Q., Zhang Q., Li G, & Li X. (2020). Integrative analysis of reference epigenomes in 20 rice varieties. Nature Communications, 11, 2658.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!