Methoctramine

Manufactured by Merck Group

Sourced in United States

Methoctramine is a laboratory reagent used for scientific research purposes. It is a muscarinic receptor antagonist that is commonly utilized in various experimental studies.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Methoctramine hydrate

11 protocols using methoctramine

Zebrafish Neuropharmacology Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

All reagents were prepared fresh on the day of the experiment and dissolved in E3 to create working solutions to be added to the experimental chamber, and compared to the addition of carrier-only controls. Gaboxadol (Sigma T101), MS222 (Sigma), mepyramine (Sigma P5514), promethazine (Sigma P4651), carbachol (Sigma C4382), eserine (Sigma E8375) and methoctramine (Sigma M105) were all dissolved in E3. H6408 (Bachem; H-6408.0001) was prepared with double-distilled (dd) H₂0 (ddH₂0) at 1 mM with a working concentration at 10 μM. Zolpidem (Sanofis Pharmaceuticals; active ingredient of the prevalent sleep drug Ambien) was a gift from S. Nishino, and stock solutions were prepared in DMSO. Effective concentrations and fish age (ranging from 7 dpf–14dpf) were chosen based on published data^{47 (link),48 (link)} or dose–response experiments driving behavioural sleep in the Viewpoint behavioural tracking system (Supplementary Table 1). At least two independent tests for all drug dose–responses were performed.
Injected MCH peptide (Phoenix Pharmaceuticals; 070–47, lot no. 429808) was prepared as a 1 mM working solution in ddH₂0 supplemented with phenol red solution (Sigma; P0290) to confirm injection (see Extended Data Fig. 7h). Intracerebroventricular pulsatile injections (FemtoJet Microinjector, Eppendorf) were performed with zPSG larvae mounted in agarose.

Leung L.C., Wang G.X., Madelaine R., Skariah G., Kawakami K., Deisseroth K., Urban A.E, & Mourrain P. (2019). Neural signatures of sleep in zebrafish. Nature, 571(7764), 198-204.

+ Open protocol

+ Expand

Electrophysiological Protocols for Neuronal Recordings

Check if the same lab product or an alternative is used in the 5 most similar protocols

The dissecting aCSF contained (in mM): 25 NaCl, 188 sucrose, 1.9 KCl, 1.2 NaH₂PO₄, 10 MgSO₄, 1 CaCl₂, 26 NaHCO₃, 25 glucose and 1.5 kynurenic acid. The recovery solution contained (in mM): 119 NaCl, 1.9 KCl, 1.2 NaH₂PO₄, 10 MgSO₄, 1 CaCl₂, 26 NaHCO₃, 20 glucose and 1.5 kynurenic acid. The recording aCSF contained (in mM): 127 NaCl, 3 KCl, 1.25 NaH₂PO₄, 1 MgCl₂, 2 CaCl₂, 26 NaHCO₃, 10 glucose. The intracellular solution for patch-clamp recordings was made of (in mM): 140 KMeSO₄, 10 NaCl, 1 CaCl₂, 10 HEPES, 1 EGTA, 3 Mg-ATP and 0.4 GTP-Na₂ (pH 7.2–7.3, adjusted with KOH). Muscarine, 4-DAMP, methoctramine, NMDA, DA and 5-HT were supplied by Sigma-Aldrich®; tetrodotoxin (TTX) by Bio-Techne®. All drugs were dissolved in H₂O except for 4-DAMP which was dissolved in DMSO to a concentration that did not exceed 0.1% (vol/vol) in working solutions.

Nascimento F., Spindler L.R, & Miles G.B. (2019). Balanced cholinergic modulation of spinal locomotor circuits via M2 and M3 muscarinic receptors. Scientific Reports, 9, 14051.

+ Open protocol

+ Expand

Pre-miR-21 Folding and Compound Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Unmodified, desalted, and HPLC purified pre-miR-21 was purchased
from Eurofins Scientific (Louisville, KY, USA). RNA was folded via
resuspending with buffer (10 mM Tris-HCl pH 7.5 with 20 mM NaCl), and heated
to 95°C for 90 sec, and allowed to cool to room temperature
overnight. Folded RNA was aliquoted and stored in −20°C until
assayed. The following sequence of pre-miR-21 was purchased:
5’-UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCU
GUCUGACA-3’
Butylcycloheptyl prodiginine (bPGN) was supplied by Developmental
Therapeutics Program (DTP), Division of Cancer Treatment and Diagnosis in
the National Cancer Institute (NCI). Plates for high-throughput screens were
provided by NCI, Molecular Targets Program (MTP). Compounds such as 5-FU,
obatoclax, prodigiosin, navitoclax, spermidine, methoctramine,
hexachlotophene, and regorafenib were purchased from Sigma Aldrich or
selleckchem.com.

Matarlo J.S., Krumpe L.R., Heinz W.F., Oh D., Shenoy S.R., Thomas C.L., Goncharova E.I., Lockett S.J, & O’Keefe B.R. (2019). The Natural Product Butylcycloheptyl Prodiginine Binds Pre-miR-21, Inhibits Dicer-Mediated Processing of Pre-miR-21, and Blocks Cellular Proliferation. Cell chemical biology, 26(8), 1133-1142.e4.

+ Open protocol

+ Expand

Reproducible Drug Combination Assay

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Indomethacin and GW9662 were purchased from Cayman Chemical (Ann Arbor, MI, USA), and methoctramine was purchased from SigmaAldrich (St. Louis, MO, USA). All of the drugs were dissolved in dimethyl sulfoxide (DMSO). DMSO was pumped with nitrogen for one minute before using it to avoid drug oxidation. Aliquots of drugs were stored at −80 °C until used and discarded after the thawing. For all experiments, the maximal concentration of DMSO in the culture medium was 0.5%, which did not influence cell viability. For immunoblotting, the cells were exposed to the drugs for 24 h, as previously described [19 (link)]. For the cell viability and combination studies, the cells were exposed to at least six concentrations of each drug for 72 h, as described in the results section.

Buelvas N., Ugarte-Vio I., Asencio-Leal L., Muñoz-Uribe M., Martin-Martin A., Rojas-Fernández A., Jara J.A., Tapia J.C., Arias M.E, & López-Muñoz R.A. (2023). Indomethacin Induces Spermidine/Spermine-N1-Acetyltransferase-1 via the Nucleolin-CDK1 Axis and Synergizes with the Polyamine Oxidase Inhibitor Methoctramine in Lung Cancer Cells. Biomolecules, 13(9), 1383.

+ Open protocol

+ Expand

UPS Reporter Transgenic Mouse Model

Check if the same lab product or an alternative is used in the 5 most similar protocols

The protocol for the care and use of animals in this study was approved by the University of South Dakota Institutional Animal Care and Use Committee. GFPu is an enhanced green fluorescence protein (GFP) modified by carboxyl fusion of degron CL1 [41 (link)]. GFPdgn is a slightly shorter version of GFPu. Both GFPu and GFPdgn are proven surrogate substrates of the UPS in cardiomyocytes [42 (link), 43 (link)]. A UPS “reporter” transgenic (tg) mouse model expressing GFPdgn was created and validated as previously described [42 (link)]. GFPdgn mice were maintained in the FVB/N inbred background [42 (link)]. Genotypes were determined using PCR analysis of tail DNA. Mice were treated with pilocarpine (1 mg/kg), M2 receptor antagonist methoctramine (1 mg/kg) (Sigma-Aldrich, St. Louis, MO), or volume corrected saline control every four hours intraperitoneally (i.p.). Pilocarpine (Pilo) is a non-selective agonist of M receptors and methoctramine (Meth) is an antagonist of the M2 receptor [24 (link)].

Ranek M.J., Kost CK J.r., Hu C., Martin D.S, & Wang X. (2014). Muscarinic 2 Receptors Modulate Cardiac Proteasome Function in a Protein Kinase G-dependent Manner. Journal of molecular and cellular cardiology, 69, 43-51.

+ Open protocol

+ Expand

Vasodilator Compound Solubilization and Krebs Solution Preparation

Check if the same lab product or an alternative is used in the 5 most similar protocols

4-DAMP, AFDX-116, tetrodotoxin (Tocris), carbachol, methoctramine (Sigma Aldrich), and indomethacin (Abcam) were solubilized in DMSO, ethanol, or distilled water. Krebs solution was composed of (mM) 120 NaCl, 5.9 KCl, 25 NaHCO₃, 1.2 NaH₂PO₄·2H₂O, 5.5 glucose, 1.2 MgCl₂, and 2.5 CaCl₂. pH was adjusted to 7.4 by bubbling the solution with 95% O₂–5% CO₂.

Alkawadri T., McGarvey L.P., Mullins N.D., Hollywood M.A., Thornbury K.D, & Sergeant G.P. (2021). Contribution of Postjunctional M2 Muscarinic Receptors to Cholinergic Nerve-Mediated Contractions of Murine Airway Smooth Muscle. Function, 3(1), zqab053.

+ Open protocol

+ Expand

Pharmacological Inhibition of MAPK/NF-κB Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Pilocarpine and methoctramine were purchased from Sigma-Aldrich (St. Louis, MO, USA). Parthenolide, LY294002 and U0126 were purchase from Selleck (Shanghai, China). Antibodies used for Western blotting were purchased from Cell Signaling Technology (Danvers, MA, USA) for Erk, phospho-p42/44 Erk (Thr202/ Tyr204), Akt, phospho-Akt (Ser473), E-cadherin, vimentin, MMP9, Snail, Zeb1, phospho-NF-κB p65 (Ser536), NF-κB p65, IκBα, phosphor-IκBα (Ser32)and β-actin.

Zhao Q., Yue J., Zhang C., Gu X., Chen H, & Xu L. (2015). Inactivation of M2 AChR/NF-κB signaling axis reverses epithelial-mesenchymal transition (EMT) and suppresses migration and invasion in non-small cell lung cancer (NSCLC). Oncotarget, 6(30), 29335-29346.

+ Open protocol

+ Expand

Pharmacological Evaluation of Caftaric Acid

Check if the same lab product or an alternative is used in the 5 most similar protocols

All chemicals used
during the study were of analytical grade. These include cyclophosphamide,
mesna, atropine, glibenclamide, indomethacin, propranolol, 4-diphenylacetoxy-N-methylpiperidine (4-DAMP), methoctramine, barium chloride,
nifedipine, carbachol, potassium dihydrogen phosphate (KH₂PO₄), potassium chloride (KCl), sodium chloride (NaCl),
sodium bicarbonate (NaHCO₃), calcium chloride (CaCl₂), glucose monohydrate (C₆H₁₂O₆ H₂O), DPPH (1,1-diphenyl-picrylhydrazyl), and magnesium
sulfate (MgSO₄), which were obtained from Sigma Chemical
Company. cyclophosphamide was reconstituted in sterile normal saline
to make an injectable solution. Caftaric acid (99%) was purchased
from Na-Ha Nutri China and reconstituted in 0.5% carboxymethylcellulose
sodium (CMC Na) for oral gavage and in methanol for the experiment
on isolated rat bladder strips. Krebs–Henseleit solution was
prepared freshly in distilled water every time before use. The dilutions
of atropine, nifedipine, and indomethacin were prepared in ethanol;
propranolol, methoctramine, carbachol, and barium chloride in distilled
water; glibenclamide in DMF (dimethylformamide); and 4-diphenylacetoxy-N-methylpiperidine (4 DAMP) in DMSO (dimethylsulfoxide).
All the dilutions were prepared freshly before use.

S.a.i.m.a., Anjum I., Najm S., Barkat K., Nafidi H.A., Bin Jardan Y.A, & Bourhia M. (2023). Caftaric Acid Ameliorates Oxidative Stress, Inflammation, and Bladder Overactivity in Rats Having Interstitial Cystitis: An In Silico Study. ACS Omega, 8(31), 28196-28206.

+ Open protocol

+ Expand

Slice Preparation and Intracellular Recording

Check if the same lab product or an alternative is used in the 5 most similar protocols

The dissecting aCSF contained (in mM): 25 NaCl, 188 sucrose, 1.9 KCl, 1.2 NaH₂PO₄, 10 MgSO₄, 1 CaCl₂, 26 NaHCO₃, 25 glucose and 1.5 kynurenic acid. The recovery solution contained (in mM): 119 NaCl, 1.9 KCl, 1.2 NaH₂PO₄, 10 MgSO₄, 1 CaCl₂, 26 NaHCO3, 20 glucose and 1.5 kynurenic acid. The recording aCSF contained (in mM): 127 NaCl, 3 KCl, 1.25 NaH₂PO₄, 1 MgC_l2, 2 CaCl₂, 26 NaHCO₃, 10 glucose. The intracellular solution for patch-clamp recordings contained (in mM): 140 KMeSO₄, 10 NaCl, 1 CaCl₂, 10 HEPES, 1 EGTA, 3 Mg-ATP and 0.4 GTP-Na₂ (pH 7.2–7.3, adjusted with KOH). NMDA, DA, 5-HT and methoctramine were supplied by Sigma-Aldrich; Clozapine-N-oxide (CNO) by Tocris and Hello-Bio; and guangxitoxin-1E by Alomone Labs. All drugs were dissolved in H₂O.

Nascimento F., Broadhead M.J., Tetringa E., Tsape E., Zagoraiou L, & Miles G.B. (2020). Synaptic mechanisms underlying modulation of locomotor-related motoneuron output by premotor cholinergic interneurons. eLife, 9, e54170.

+ Open protocol

+ Expand

Assessing ADSC Viability via MTT Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

To evaluate the cell viability, ADSCs were seeded on 24-well plate at the density of 25×10 3 cells/well. After 24h cells were treated with 100μM APE (Sigma-Aldrich, St. Louis, MO, USA) at 24, 48, and 72h. Cells were also treated with muscarinic receptor antagonist (10 -7 M Methoctramine, 10 -7 M Pirenzepine and 10 -8 M 4-DAMP; Sigma-Aldrich, St. Louis, MO, USA) 2h before APE treatment. Cell growth was assessed by colorimetric assay based on 3-(4,5dimethyl thiazol 2-y1)-2,5-diphenyl tetrazolium bromide (MTT, Sigma-Aldrich, St. Louis, MO, USA). For each well, the OD at 570 nm was measured by GloMax Multi Detection System (Promega, Madison, WI, USA).

Piovesana R., Melfi S., Fiore M., Magnaghi V, & Tata A.M. (2018). M2 muscarinic receptor activation inhibits cell proliferation and migration of rat adipose-mesenchymal stem cells. Journal of cellular physiology, 233(7).

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!