Celecoxib was purchased from Selleck Chemicals (Houston, TX, USA). X-ray radiation was conferred by Radsource 2000 from Radsource, LLC (Brentwood, TN, USA). TRIzol® and primers were purchased from Invitrogen (Thermo Fisher Scientific, Inc., Waltham, MA, USA) and the ThermoScript RT reverse transcription-polymerase chain reaction (RT-PCR) kit was purchased from Fermentas (Thermo Fisher Scientific, Inc.). The PCR Amplification kit was obtained from Takara Bio, Inc., (Otsu, Japan). The Annexin V-Fluorescein Isothiocyanate (FITC) kit (cat. no. KFG001) was purchased from Nanjing KeyGen Biotech Co., Ltd. (Nanjing, China). Hoechst 33258 was purchased from Beyotime Institute of Biotechnology (Haimen, China). The laser confocal scanning microscope, flow cytometer, PCR thermocycler, gel electrophoresis imaging system and cell culturing equipment were all obtained from The Second Affiliated Hospital, Suzhou University (Suzhou, China).
Pcr amplification kit
Manufactured by Takara Bio
Sourced in Japan, China
The PCR amplification kit is a laboratory tool used for the exponential amplification of DNA sequences. It contains the necessary reagents, including DNA polymerase, primers, and buffers, to perform the polymerase chain reaction (PCR) process.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (11 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
Gel imaging system, by Bio-Rad (3 mentions)
Quantity one 4, by Bio-Rad (3 mentions)
Trizol, by Thermo Fisher Scientific (3 mentions)
Primescript 2 1st strand cdna synthesis kit, by Takara Bio (2 mentions)
Dneasy blood tissue kit, by Qiagen (2 mentions)
Universal dna purification kit, by Tiangen Biotech (2 mentions)
Clonexpress 2 one step cloning kit, by Vazyme (2 mentions)
Tianprep rapid mini plasmid kit, by Tiangen Biotech (2 mentions)
Superscript first strand synthesis system, by Thermo Fisher Scientific (2 mentions)
Abi 3730 automated sequencer, by Thermo Fisher Scientific (2 mentions)
Primescript rt reagent kit, by Takara Bio (2 mentions)
Revertaid first strand cdna synthesis kit, by Thermo Fisher Scientific (2 mentions)
Hoechst 33258, by Beyotime (1 mentions)
Celecoxib, by Selleck Chemicals (1 mentions)
Synergy h1, by Agilent Technologies (1 mentions)
Trizol, by Roche (1 mentions)
Confocal microscopy, by Leica (1 mentions)
Anti flag m2 monoclonal antibody, by Merck Group (1 mentions)
42 protocols using pcr amplification kit
1
Celecoxib and Radiation-Induced Apoptosis
2
Analyzing Gene Expression in Infarcted Hearts
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
After dissection, the total RNA of the infarcted heart tissue was extracted using Trizol (Roche). The RNA concentration and purity were measured using a microplate reader (Synergy H1, BioTek, USA). RNA reverse transcription was performed using Reverse Transcriptase (Takala) in accordance with the manufacturer's instructions. PCR amplification was conducted using a PCR amplification kit (Takara) with gene-specific primers of basic fibroblast growth factor (bFGF), insulin-like growth factor-1 (IGF-1), and hepatocyte growth factor (HGF). The sequences of the PCR primer pairs (5′ to 3′) used for each gene are as follows: bFGF, AGCGGCTCTACTGCAAGAAC (forward) and TCGTTTCAGTGCCACATACC (reverse); IGF-1, GAGCGCACCTCCAATAAAGA (forward) and TCAGCGGAGCACAGTACATC (reverse); HGF, TATTGCCCTATTTCCCGTTG (forward) and GTTTCTCCTCGCCTCTCTCA (reverse). Amplification of β-actin from the same amount of cDNA was used as an endogenous control. Agarose gel electrophoresis at 135 V for 45 min was carried out to analyze the products, and the relative amount of each target gene was normalized to the expression of β-actin.
3
Genetic engineering of Plasmodium parasite
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted from Hepa1-6 cells using TRIzol Reagent (Invitrogen) according to the manufacturer's protocols. A PrimeScript® II 1st strand cDNA Synthesis kit (Takara) was used to synthesize the cDNA, and then, gpc3 was amplified using a Takara PCR amplification kit. The following primers were used: gpc3-Bam H I-forward: 5′-AGGATCCATGGCCGGGACCGTGCGCACC GCGT- 3′, gpc3-Xba I-2×Flag-reverse: 5′-GGTCTAGAGAGAC CTTACTTATCGTCGTCATCCTTGTAATCCTTATCGT CGTCATCCTTGTAATCGTGCACCAGGAAAAAAAA GCACGCC-3′. For homologous recombination, the gpc3 gene was introduced into the genome of P.y-WT using a pL0017 plasmid by electroporation as previously described [58 (link)]. Pyrimethamine (Sigma) was used to select and clone Pyrimethamine-resistant parasites in mice. Parasite genomic DNA was extracted using the DNeasy blood & tissue kit (QIAGEN). The integration of the exogenous gene into the parasite genome was confirmed by PCR analysis of parasite genomic DNA. GPC3 expression in parasites was detected with western blotting [42 (link)] and confocal microscopy (Leica) [59 (link)]. Monoclonal anti-Flag@M2 antibody (Sigma, mouse, #088K6018) was used for western blot and detailed data about other antibodies involved in this experiment were mentioned previously.
4
Multi-step Molecular Cloning Workflow
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For PCR experiments, standard protocols were applied with a PCR amplification kit (TaKaRa, Cat. # R011). Fungal RNA was extracted by means of the RNAsimple Total RNA Kit (TIANGEN Cat. # DP419). Plasmid DNA was isolated from E. coli using the TIANprep Rapid Mini Plasmid Kit (TIANGEN Cat. # DP105–03). DNA fragments separated in an agarose gel were extracted with the Universal DNA Purification Kit (TIANGEN Cat. # DP214–03). Multiple fragments were assembled via the ClonExpressTM II One Step Cloning Kit (Vazyme Biotech Co., Ltd., China). Strains P. pastoris GS115 and E. coli TOP10 and yeast vectors pPICZ B and pPIC3.5 K were purchased from Invitrogen. Transformation of yeast cells and screening of transformants were executed according to Pichia protocols39 . Yeast two-hybrid (Y2H) assay were described in detail in supplementary data file (Supplementary Fig. S7 ).
5
Sequencing of UGT1A1 Gene by Pyrosequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sequence analysis of UGT1A1 was identified by pyrosequencing, as described previously.8 (link) Briefly, we extracted genomic DNA from peripheral blood, using QIAamp Blood Kit (Qiagen, Hilden, Germany). Fragments were amplified using TaKaRa polymerase chain reaction (PCR) Amplification Kit (TaKara Bio Inc., Japan). Prosequencing assay was performed with the PyroMark Q24 ID system (Qiagen) following the manufacturer’s instructions.
6
APP Overexpression in SH-SY5Y Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the overexpression of APP, the sequences encoding APP were amplified through reverse-transcription PCR using a PCR Amplification Kit (TaKaRa Biotechnology, China) and subcloned into pCMV vectors (named pCMV-APP; Beyotime, China). The empty vector served as negative control (NC). Subsequently, SH-SY5Y cells were transfected with pCMV-APP and empty vector using Lipofectamine 2000 Reagent (Invitrogen), whose effects were determined 48 h later using quantitative PCR and Western blot.
7
Quantifying Notch3 Expression in Cardiac Tissues
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from CFs and myocardial tissue was extracted using TRIzol (Takara, Japan). Reverse transcription was carried out with the PrimeScript RT reagent Kit with gDNA Eraser (Takara, Japan). The qPCR primers were obtained from Invitrogen (Carlsbad, CA, United States). The primer sequences were as follows:
Notch3 gene expression was quantified by PCR Amplification Kit (Takara, Japan). Briefly, the PCR included the following steps: denaturation of cDNA at 95°C for 30 s, followed by 40 cycles of 95°C for 5 s (denaturation) and 60°C for 30 s (annealing and elongation). GAPDH was used as a loading reference. Differential expression values were calculated using the ΔΔCT method.
Notch3 gene expression was quantified by PCR Amplification Kit (Takara, Japan). Briefly, the PCR included the following steps: denaturation of cDNA at 95°C for 30 s, followed by 40 cycles of 95°C for 5 s (denaturation) and 60°C for 30 s (annealing and elongation). GAPDH was used as a loading reference. Differential expression values were calculated using the ΔΔCT method.
8
Genomic DNA Extraction and Sequencing from FFPE Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was extracted from dissected formalin-fixed paraffin-embedded (FFPE) tumor tissue blocks using the QIAamp DNA FFPE Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instruction. DNA sequences including each SNP of interest were amplified from the genomic DNA by polymerase chain reaction (PCR) as reported before [13 (link)] using commercial PCR Amplification Kit (TaKaRa, Dalian, China). After amplification, the purified PCR fragments were directly sequenced using the dideoxy chain termination method of sequencing.
9
RNA Extraction and PCR Analysis of IL-6 and TNF-α
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The differentiated 3T3-L1 cells were plated in 35 mm dishes (2 × 105 cells/dish) and treated with or without PSPLE for 72 h. Then, cells were detached and thoroughly washed with cold PBS. RNA was extracted using TRIzol Reagent according to the manufacturer's protocol (Invitrogen, CA, USA). Total RNA (1 μg) was reverse-transcribed using a SuperScript II Reverse Transcriptase Kit (Invitrogen, CA, USA). Aliquots of cDNA were subjected to polymerase chain reaction (PCR) with a PCR Amplification Kit (Takara Bio Inc., Shiga, Japan). Conditions for PCR included initial denaturation at 94°C for 1 min, followed by 98°C for 5 s, 55°C for 5 s, and 72°C for 10 s for 30 cycles. The primers used in this study were as follows: IL-6, forward 5′- CATATAAAATAGTCCTTGCTACCCCAACT -3′ and reverse 5′- CCACTCCTTCTGTGACTCTAACTTGTC -3′; TNF-α, forward 5′- GGCAGGTCTACTTTGGAGTCATTG -3′ and reverse 5′- ACATTCCGGGATCCAGTGAGTTCCG -3′; and β-actin, forward 5′- TCAGCAAGCAGGAGTACGATGA -3′ and reverse 5′- TGCGCAAGTTAGGTTTTGTCAA -3′. The PCR products were separated by electrophoresis on a 2% agarose gel and stained with ethidium bromide.
10
Screening and Cloning of oacC Gene in Shigella
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Primer pairs used in this study are listed in Table 3 . The oacC-1 primer pair was used for oacC gene detection. The oacC-2 primer pair was used for oacC gene function analysis. The oacC-3 and oacC-4 primer pairs were used to amplify regions up and downstream of oacC in serotype 6 isolates. Oligonucleotide primers were synthesized by Sangon Biotech (Shanghai). PCR amplifications were performed using a TaKaRa PCR Amplification Kit (Takara, Japan) following a standard protocol. PCR products amplified from strain 51579 using the oacC-2 primer pair were purified and cloned into the T-vector pMD20T (TaKaRa, Japan), which carries an additional T at both 3′ terminus and can complement the A base of the PCR product, to generate the pSQZ5 expression plasmid. The recombinant plasmids were first transformed into commercial E. coli DH5α competent cells (TaKaRa, Japan), and then into S. flexneri strains tested, using a standard protocol [30 ]. The transformants were selected on LB plates supplemented with ampicillin (100 μg ml−1) and further confirmed by PCR amplification of the oacC gene.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!