Src py416

Manufactured by Cell Signaling Technology

Sourced in United Kingdom

Src pY416 is a lab equipment product that detects the phosphorylation of tyrosine 416 in the Src protein. This phosphorylation site is important for the activation of the Src kinase.

Automatically generated - may contain errors

Lab products found in correlation

17 protocols using src py416

FAK Inhibitor Effects on Cell Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

The antibodies and inhibitors used are as follows: active caspase 3, poly ADP ribose and vimentin (R&D Systems); Akt, Akt-pS473, ErbB2, ErbB2-pY1248, ErK-pT202/T204, FAK-pY925 and Src-pY416 (Cell Signaling); FAK-pY397, FAK-pY576, FAK-pY577 and paxillin-pY31 (Invitrogen); E-cadherin and paxillin (BD Transduction Laboratories); anti-V5 (Serotec); FAK and N-cadherin (Santa Cruz); actin and tubulin (Sigma); FAK pY407, FAK pY861 and paxillin pY118 (Biosource); secondary antibodies (Jackson Laboratory); Hoechst 33528 (Sigma). The FAK inhibitor AZ675 was provided by AstraZeneca (Alderly Edge).

Walker S., Foster F., Wood A., Owens T., Brennan K., Streuli C.H, & Gilmore A.P. (2016). Oncogenic activation of FAK drives apoptosis suppression in a 3D-culture model of breast cancer initiation. Oncotarget, 7(43), 70336-70352.

+ Open protocol

+ Expand

Proximity Ligation Assay for Protein Interactions

Check if the same lab product or an alternative is used in the 5 most similar protocols

Proximity ligation assay was performed as described using the Duolink Starter Kit (Sigma). H1299 cells were transfected and treated as per instructions before overnight incubation with primary antibodies (SRC, SRC pY416, and SRC pY527 [Cell Signaling]; ZsGreen [Clontech]; RASSF1A [Epitomics]; RASSF1C [Abcam]; FLAG tag [Sigma]; and HA tag [Millipore]) and secondary antibodies for 1 hr. Hybridization was performed for 30 min in a humidified chamber, ligation reactions for 30 min, amplification for 100 min, and DAPI was used for cell detection. The dot-like structures were imaged using Zeiss LSM780 microscope using a 63× objective. For each cell, five z stack images were taken and analyzed with BlobFinder V3.2 (Uppsala University) [54 (link)]. The average values, SEM, and significance were calculated using Prism 6.0 (Graphpad) software.

Vlahov N., Scrace S., Soto M.S., Grawenda A.M., Bradley L., Pankova D., Papaspyropoulos A., Yee K.S., Buffa F., Goding C.R., Timpson P., Sibson N, & O’Neill E. (2015). Alternate RASSF1 Transcripts Control SRC Activity, E-Cadherin Contacts, and YAP-Mediated Invasion. Current Biology, 25(23), 3019-3034.

+ Open protocol

+ Expand

Quantitative Immunoblotting of Cell Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Protein containing samples (equivalent of 5 × 10⁶ cells) were loaded onto a 4–15% precast Criterion polyacrylamide gel (Biorad). The separated proteins were transferred onto PVDF membranes (Millipore), and then blocked for 1 h at room temperature in a 1:1 1XPBS:SEA Block buffer (Thermo Scientific). The PVDF membranes were then incubated with primary antibodies against GRB2 (clone 23, Santa Cruz Biotechnology), LAT pY226 (clone J96-1238.58.93, BD Pharmingen), LAT pY132 (Genetex), SLP-76 pY128 (clone J141-668.36.58, BD Pharmingen), ERK1/ERK2 pY187/pT185 (Invitrogen), p38 pT180/pY182 (Cell Signaling), JNK pT183/pY195 (Cell Signaling), Akt pS473 (clone-14-6, Invitrogen), Src pY416 (Cell Signaling), pY783 PLC-γ1 (Cell signaling), PLC-γ1 (Cell Signaling), lymphocyte-specific protein tyrosine kinase (LCK) (Cell Signaling), pY (4G10, Millipore), Gsk3αβ pS21/9 (Cell Signaling), actin (clone C4, Millipore), or GAPDH (Meridian Life Sciences). Secondary antibodies conjugated to IRDye 800CW or IRDye 680 were diluted in SEA Block and incubated with the PVDF membranes for 30 min at room temperature. The membranes were then visualized using the Licor Odyssey Infrared detector.

Bilal M.Y, & Houtman J.C. (2015). GRB2 Nucleates T Cell Receptor-Mediated LAT Clusters That Control PLC-γ1 Activation and Cytokine Production. Frontiers in Immunology, 6, 141.

+ Open protocol

+ Expand

Antibody Characterization for Src Signaling

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following antibodies were used in this study: Src (Cell Signaling Technology, 32G6); Src pY416 (Cell Signaling Technology, D49G4); Itk (Cell Signaling Technology, 2F12); Btk pY551 (Itk pY511) (BD Pharmingen clone 24a).

von Raußendorf F., de Ruiter A, & Leonard T.A. (2017). A switch in nucleotide affinity governs activation of the Src and Tec family kinases. Scientific Reports, 7, 17405.

+ Open protocol

+ Expand

Protein Expression Analysis in Cell Lysates

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cell lysates were prepared in RIPA lysis buffer supplemented with 1 μg each of pepstatin, leupeptin, aprotinin, and 200 μg/ml phenylmethylsulfonyl fluoride. Antibodies used include: human ERBB2, ERBB2 (pY1248), AKT, AKT (pS473), BIM, cleaved-caspase-3, p27, SRC, SRC(pY416), (Cell Signaling Technology Danvers, MA); HIF-1α were from Novus (Littleton, CO); β-actin, Erk1/2, pErk1/2, DUSP2 and HRP-conjugated secondary antibodies from Santa Cruz Biotechnology (Santa Cruz, CA).

Karakashev S.V, & Reginato M.J. (2015). Hypoxia/HIF1α induces lapatinib resistance in ERBB2-positive breast cancer cells via regulation of DUSP2. Oncotarget, 6(4), 1967-1980.

+ Open protocol

+ Expand

miRNA-128 Regulation of Stem Cell Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols

miRNA isolation was carried out using miRNeasy (Qiagen) in cells treated with or without prior VEGFA, saracatinib, or 5′‐azacytidine (Sigma‐Aldrich). cDNA synthesis used Ncode miR First Strand cDNA synthesis kit (Invitrogen). qPCR of miR‐128 used miR‐128 forward: 5′‐TCACAGTGAACCGGTCTCTTT‐3′ and Universal reverse primer (Ncode miR First Strand cDNA synthesis kit, Invitrogen). Three different siRNA oligos to each of SRC, BMI1, and DNMT3A and scrambled controls were purchased from Santa Cruz Biotech (Dallas). Knockdown was assayed after 48 h by Western blot as described (Zhao et al, 2014). AntagomiR‐128 and its control were purchased from Exiqon (Denmark) and transduced into cells as per manufacturer's protocol. Bmi1, pStat3, Myc, Klf4, Oct4, SrcpY416, Src, VEGFR2pY1175, VEGFR2, and DNMT3A antibodies were from Cell Signaling. β‐actin antibody was from Santa Cruz Biotech. Densitometric analysis was carried out for Western blot data using three different exposures of three different biologic assays and data presented as fold change expression ± SEM.

Jang K., Kim M., Gilbert C.A., Simpkins F., Ince T.A, & Slingerland J.M. (2017). VEGFA activates an epigenetic pathway upregulating ovarian cancer‐initiating cells. EMBO Molecular Medicine, 9(3), 304-318.

+ Open protocol

+ Expand

Immunoblotting for Signaling Protein Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total cell lysates were harvested in hot SDS sample buffer. For immunoprecipitation, cells were lysed in RIPA buffer. DDR1 was immunoprecipitated with anti-DDR1 (Santa Cruz) antibody. Immunoprecipitated proteins were eluted with SDS sample buffer. Proteins were separated by SDS-PAGE. After electrophoresis, the proteins were transferred to nitrocellulose membrane. The membrane was incubated overnight at 4°C with primary antibodies, washed with TBS-T (TBS with 0.1% Tween-20), and incubated with HRP-conjugated secondary antibodies at room temperature for 1 hour. Immuno-reactive protein was detected using SuperSignal West Pico Chem KIT (Thermo Scientific, USA). Primary antibodies used were against ERK, ERK pT202/pY204, Akt, Akt pS473, Src, Src pY416 (Cell Signaling), FAK (BD Transduction Laboratories), FAK pY397 (Millipore), α1(IV) (Abgent), α2(IV) (Abcam), DDR1, phosho-tyrosine (pY99), ubiquitin (Santa Cruz), α5(IV) (Proteintech), MEK1 (Abmart) and Actin (Sigma-Aldrich). Western blots were scanned and analyzed with Image J.

Xiao Q., Jiang Y., Liu Q., Yue J., Liu C., Zhao X., Qiao Y., Ji H., Chen J, & Ge G. (2015). Minor Type IV Collagen α5 Chain Promotes Cancer Progression through Discoidin Domain Receptor-1. PLoS Genetics, 11(5), e1005249.

+ Open protocol

+ Expand

Western Blot Antibody Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Detection reagents, manufacturers, and concentration ranges for all primary and secondary antibodies utilized in Western blot imaging are as follow: Pyk2 (Cell Signaling #3480S, 1:1,000, Danvers, USA), Pyk2 pY402 (Abcam #4800, 1:1,000, Cambridge, UK), PKCα (Cell Signaling #2056S, 1:1,000), PKCα pT638 (Abcam #32502, 1:5,000), Src (Cell Signaling #2123S, 1:1,000), Src pY416 (Cell Signaling #6943, 1:1,000), ERK1/2 (Cell Signaling #4695, 1:2,000), ERK1/2 pT202/pY204 (Cell Signaling # 9101S, 1:2,000), Cx43 pY265 (Abcam #193373, 1:1,000), Cx43 pS279 (Invitrogen # PA5-64640, 1:2,000), Cx43 pS282 (Invitrogen # PA5-64641, 1:2,000), Cx43 (Sigma #6219, 1:10,000), Anti-rabbit IgG - HRP-linked Antibody (Cell Signaling #7074, 1:1,000 to 10,000), Anti-mouse IgG - HRP-linked Antibody (Cell Signaling #7076, 1:1,000).

Zheng L., Chenavas S., Kieken F., Trease A., Brownell S., Anbanandam A., Sorgen P.L, & Spagnol G. (2020). Calmodulin Directly Interacts with the Cx43 Carboxyl-Terminus and Cytoplasmic Loop Containing Three ODDD-Linked Mutants (M147T, R148Q, and T154A) that Retain α-Helical Structure, but Exhibit Loss-of-Function and Cellular Trafficking Defects. Biomolecules, 10(10), 1452.

+ Open protocol

+ Expand

Epithelial-Mesenchymal Transition Protein Profiling

Check if the same lab product or an alternative is used in the 5 most similar protocols

50µg of whole cell lysates were resolved on 10% SDS-PAGE gels before transfer of proteins onto nitrocellulose membrane which was followed by blocking in 5% milk and incubation with primary antibodies against human E-cadherin, N-cadherin, Fibronectin (BD biosciences), Slug, Snail, vimentin, Src, Src-pY⁴¹⁶, AKT-pS⁴⁷³, AKT (Cell signalling), p63 (Abcam), Twist, ZEB1, ZEB2 (Santa Cruz Biotech) GAPDH and β-actin (Sigma-Aldrich). Using HRP-tagged species specific-secondary antibodies, the differential protein expressions were visualised by chemiluminescence detection.

Srivastava K., Pickard A., Craig S.G., Quinn G.P., Lambe S.M., James J.A., McDade S.S, & McCance D.J. (2018). ΔNp63γ/SRC/Slug signalling axis promotes epithelial-to-mesenchymal transition in squamous cancers. Clinical cancer research : an official journal of the American Association for Cancer Research, 24(16), 3917-3927.

+ Open protocol

+ Expand

Integrin-mediated Signaling Pathway Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The antibodies used are ERK, ERK pT202/pY204, Akt, Akt pS473, Src, Src pY416, cleaved caspase-3 (Cell Signaling), FAK (BD Transduction Laboratories), FAK pY397 (Millipore), Ki-67 (Novocastra Laboratories), α1(IV) (Abgent), α2(IV) and CD31 (Abcam), α5(IV) (rabbit ployclonal antibody from Proteintech (western blot) and rat monoclonal antibody clone b14 (immunostaining) provided by Dr. Yoshikazu Sado, Shigei Medical Research Institute [36 (link)]), DDR1, phosho-tyrosine (pY99), ubiquitin (Santa Cruz), MEK1 (Abmart), Actin (Sigma-Aldrich), biotinylated goat anti-rabbit secondary antibody (Zymed), Alexa Fluor 555/488 conjugated anti-mouse, rat or rabbit IgG secondary antibodies (Invitrogen). Expression level of integrins on A549 cell surface was determined by immunofluorescence flow cytometry with anti-β1 (Thermo Scientific Pierce), α1, α2 and α11 (Santa Cruz) integrin antibodies as described [37 (link)]. Cycloheximide, MG132 and NH₄Cl were purchased from Sigma-Aldrich.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!