siRNAs against XIST (si-XIST-1, si-XIST-2), siRNA control (si-con), pcDNA-XIST, pcDNA empty vector (vector), miR-29c mimic (miR-29c), miRNA control (miR-con), miR-29c inhibitor (anti-miR-29c), and control inhibitor (anti-miR-con) were purchased from GenePharma Co., Ltd. (Shanghai, China). NPC cells were seeded into 6-well plates and cultured with complete medium without antibiotics at least 24 h prior to transfection. Then, cells were transiently transfected with siRNAs, miRNAs, or pcDNAs, or cotransfected with si-XIST and anti-miR-29c or anti-miR-con using Lipofectamine™ 2000 (Invitrogen). The cells were harvested at different time points for analysis post-transfection.
Anti mir 29c
Manufactured by Thermo Fisher Scientific
Anti-miR-29c is a laboratory reagent designed to inhibit the expression of the microRNA miR-29c. It is intended for use in research applications to study the role and function of miR-29c in various biological processes.
Automatically generated - may contain errors
2 protocols using anti mir 29c
1
Investigating XIST and miR-29c in NPCs
2
Modulating RP11-79H23.3 and miR-29c in Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RP11-79H23.3 siRNA was obtained from RiboBio company (Guangzhou, China), while miR-29c mimics and Anti-miR-29c from GenePharma (Shanghai, China). The synthetic RP11-79H23.3 siRNA (20 nM), miR-29c mimics (50 nM), and Anti-miR-29c (50 nM) were mixed with Lipofectamine 2000 (Invitrogen, Shanghai, China) and added into the cell medium according to the instructions of manufacturer. After transfection for 48 h, both RNA and protein samples were extracted for further analysis. The siRNA, miRNA mimics and inhibitor (Anti-miR-29c) sequences applied in the study were as follows: RP11-79H23.3 siRNA-1: GTAACCCTTTCATGTCATT; RP11-79H23.3 siRNA-2: GTTCTCACATCGCTAACAA; RP11-79H23.3 siRNA-3: CCTATTTCTTACCATCCTT; RP11-79H23.3 siRNA-4: ATGACTTCCCTCTCCTAAGT; RP11-79H23.3 siRNA-5: ATATGTGATTCTCAGACCTC; RP11-79H23.3 siRNA-6: TTGGATCCCTAAGTAACTGA. miR-29c mimics: 5′-UAGCACCAUUUGAAAUCGGUUA-3′, 5′-ACCGAUUUCAAAUGGUGCUAUU-3′; Anti-miR-29c: 5′-UAACCGAUUUCAAAUGGUGCUA-3′.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!