Lysostaphin
Lysostaphin is a bacteriocin enzyme produced by Staphylococcus simulans. It has the ability to lyse the cell walls of Staphylococcus aureus, including methicillin-resistant strains (MRSA).
Lab products found in correlation
13 protocols using lysostaphin
Rapid S. aureus DNA Extraction
Bacterial RNA Isolation Protocol
(Sangon Biotech, Shanghai, China) in 100 mL of 50 mM EDTA. Purified RNA was eluted with DNase/RNase-Free Water (Beyotime, Shanghai, China), and the integrity of the RNA was confirmed by 1% agarose gel electrophoresis. RNA quantity and purity were determined by a Microvolume UV‒Vis Spectrophotometer (NanoDrop One, Thermo Fisher Scientific, USA).
Extracting MRSA Genomic DNA
Genomic DNA Extraction from Antibiotic-Resistant S. aureus
Rapid DNA Extraction from S. aureus
Extraction of Genomic DNA from Staphylococcus aureus
Molecular Detection of Staphylococcal Virulence Factors
PCR was run as follows: pre-denaturation at 93°C for 3 minutes, denaturation at 93°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72°C for 1 minute. PCR products were sequenced and analyzed by BLAST for the expected sequences of peptides. Primers for pvl gene (PVL-F, 5′–ATCATTAGGTAAAATGTCTGGACATGATCCA–3′; and PVL-R, 5′–GCATCAAGTGTATTGGATAGCAAAAGC–3′) were used to generate an internal control with an amplicon size of 433 bp.27 (link)
Bacterial Invasion Assay in A549 Cells
RNA Extraction from Bacterial Samples
The RNA from each sample was used for transcriptome sequencing and quantitative real-time polymerase chain reaction (RT-qPCR).
Bacterial Cell Lysis and RNA Extraction
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!