pCMV-Myc-ETS2 wild-type and deletion mutants, HA-mtp53 R248W, Flag-ETVl, Flag-ETV4, Flag-ETV5, pCMV-β-galactosidase and HA-poly ubiquitin plasmids have been described previously [29 (link)]. Human COP1 and DET1 cDNA (GE Dharmacon, Lafayette, CO, USA) was amplified by PCR and subcloned into pCMV-Myc (Clontech, Mountain View, CA, USA). pCMV-Myc COP1 was used as a template to generate the COP1 RING mutant Cl36ACl39A. pCMV-Myc-ETS2 construct was used as a template to generate mutations V52AP53A, Vl87APl88A, and V308AP309A. All mutagenesis was accomplished using the Q5® Site-Directed Mutagenesis Kit from New England BioLabs (Ipswich, MA, USA) and appropriate mutagenesis primers generated by using the NEBaseChanger™ tool. Mutations were verified by sequencing.
Nebasechanger tool
Manufactured by New England Biolabs
Sourced in United States
The NEBaseChanger tool is a laboratory device designed to facilitate enzyme-mediated DNA manipulation. It provides a simple and efficient way to change the DNA restriction enzyme recognition sequence, enabling users to adjust DNA fragments for various applications.
Automatically generated - may contain errors
Lab products found in correlation
Q5 site directed mutagenesis kit, by New England Biolabs (8 mentions)
Pcmv myc, by Takara Bio (1 mentions)
In fusion hd cloning kit, by Takara Bio (1 mentions)
4d nucleofector system, by Lonza (1 mentions)
Complete endothelial cell medium, by Cell Biologics (1 mentions)
Primerquest tool, by Integrated DNA Technologies (1 mentions)
Pcmv6 empty vector, by OriGene (1 mentions)
Q5 site directed mutagenesis, by New England Biolabs (1 mentions)
Pcpgf promlc, by InvivoGen (1 mentions)
10 protocols using nebasechanger tool
1
Plasmid construction and mutagenesis
2
Plasmid Constructs for Viral T Antigen Study
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
pCMV24-3xFLAG-Fbw7α wild-type and mutants, pCS2-5xMyc-Fbw7α, pCMV24-3xFLAG-Fbw1 wild-type and mutants, pCS2-HA-SV40 LT, and pCS2-HA-c-Myc have been described [21 (link), 23 (link), 24 (link), 27 (link), 29 (link), 31 (link), 32 , 42 (link)]. MCPyV T antigens were subcloned into pCS2, and/or pCS2-HA vectors using the In-fusion HD Cloning Kit (Clontech). The pCS2-MCPyV.57kT plasmid was generated by GENEWIZ TurboGENE Gene Synthesis. The MCPyV LT alanine scan mutagenesis was performed by ThermoFisher Scientific GeneArt. MCPyV T antigen mutants were generated using New England BioLabs Q5 Site-Directed Mutagenesis Kit, with primers designed using the NEBase Changer tool (New England Biolabs). pCGN.HA-Fbw7 and pCGN.HA-Fbw7 R465C were provided by Patrick Moore and Yuan Chang (University of Pittsburgh).
3
Cloning and Tagging of SlPRA1A and LeEIX2 Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For overexpression assays, SlPRA1A cDNA (Solyc03g121460) C-terminally tagged with GFP, mCherry or 2xHA was cloned into pBINPLUS (van Engelen et al., 1995 (link)) using the following primers: SlPRA1A forward primer 5′-TAGTCGACATGACGAATTACGGCACAATACC-3′ and SlPRA1A reverse primer 5′-TAGGATCCAGACGACGGAGCAGAAG-3′, between the CAM35SΩ promoter containing the translation enhancer signal and the NOS terminator. SlPRA1A N62T and Y70A single mutations were generated sequentially using Q5® Site-Directed Mutagenesis Kit (New England Biolabs). Primers were designed using the NEBaseChanger tool from the New England Biolabs inc. website. The N62T mutation was generated using the following primers: forward primer 5′-AATCAAGACAACTTTCTCCTTCTTC -3′ and reverse primer 5′-CGTGATATAGCATCGCTG -3′. The Y70A mutation was generated using the following primers: forward primer 5′-CCAGACGAACGCCGCCATCATAGTG -3′ and reverse primer 5′-AAGAAGGAGAAAGTTGTC -3′. The mutations were verified by sequencing and the mutated SlPRA1 was cloned into pBINPLUS (van Engelen et al., 1995 (link)) for tagging with GFP or mCherry. LeEIX2 cDNA (Solyc07g008630) C-terminally tagged with GFP was cloned into the SalI site of pBINPLUS (van Engelen et al., 1995 (link)) using the following primers: LeEIX2 forward primer 5′-ATGTCGACATGGGCAAAAGAACTAATC-3′ and LeEIX2 reverse primer 5′-ATGTCGACGTTCCTTAGCTTTCCCTTCAGTC-3′.
4
Optimized SARS-CoV-2 Spike Protein Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA sequences of scaffolds, HR1, HR2, and the SUMO tag were codon-optimized for E. coli by the GeneOptimizer algorithm (51 (link)), synthesized by the Integrated DNA Technologies company, and cloned into the Duet expression system (Novagen) using Gibson assembly (52 (link)) (see SI Appendix, Supplementary Notes for details). The final optimized constructs for the wild-type HR1 and HR2 fragments contain residues 917–988 and 1162–1201 of the spike protein, respectively. The constructs for the cell–cell fusion assay (18 (link)) were kindly provided by Bing Chen, Harvard Medical School, Boston, including the full-length wild-type S, the full-length wild-type ACE2, and the α-fragment and ω-fragment of E. coli β-galactosidase, all cloned in the pVRC8400 vector (53 (link)). Point mutations and short insertions were introduced using the Q5 site-directed mutagenesis kit with primers designed by the NEBaseChanger tool (New England Biolabs). The construct for the enhanced SUMO protease with a C-terminal deca-histidine tag was purchased from Addgene (pCDB302, Addgene ID 113673) (54 (link)). The NEB Turbo competent E. coli cells were used to replicate the constructs.
5
Palmitoylation Regulation of PLCβ1 in Endothelial Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All Zdhhc and PLCβ1 siRNA were purchased from Santa Cruz Biotech. pCMV6 empty vector, and ZDHHC21 plasmids were purchased from Origene; and pLX304 empty vector and PLCβ1 plasmids were purchased from Genecopoeia. MLMVECs grown to 90% confluence were trypsinized, pelleted, and resuspended in 100 μl of P5 Primary Cell 4D-NucleofectorTM X with 1 μM siRNA or 2 μg plasmid. Cells were rapidly electroporated using the 4D-NucleofectorTM System (Lonza, MD, USA) and plated in Endothelial cell complete medium (Cell Biologics) for experiments. Mutation at potential palmitoylation site of PLCβ1 was created by mutagenesis using as template the pLX304 with PLCβ1 transcript variant 1 cDNA clone purchased from Genecopoeia; and the Q5 Site-Directed Mutagenesis Kit with supplied 5-alpha competent cells purchased from New England BioLabs. PLCβ1 C17S mutagenesis primers (Fw: 5′ AAGCCCGTGTCCGTGTCCGAC 3′; Rev: 5′ GAGTTGCAAGGCGTGCAC 3′) were designed using the NEBaseChanger tool also provided by New England BioLabs. Successful mutation of C17S was confirmed by sequencing using (Fw: 5′ ACATCAATGGGCGTGGATAG 3′; Rev 5′ GGAAAGCCACGAGATTCAAATG 3′) designed with the PrimerQuest tool provided by Integrated DNA Technologies and Sanger sequencing of PCR product provided by Genewiz.
6
Modifying pGEX-5X3-Nedd4 Plasmid
7
Methylation-Free CTSH Intron 1 Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
A DNA sequence spanning an intron 1 region of CTSH (chr15: 79,236,578–79,237,097, hg19) was cloned into the intron of the pCpG-free-lucia plasmid (Invivogen; catalog no.: pcpgf-promlc), which was denoted as pCpG-free-CTSH intron 1-lucia plasmid thereafter. The expression of the lucia gene was driven by a modified human EF-1α promoter. The modified EF-1α promoter in the pCpG-free-lucia plasmid was devoid of CpG sites and therefore was ideal for this experiment because it allowed us to only methylate the CTSH intron 1 without getting methylated itself. In contrast, the CTSH promoter is enriched with CpG sites. CTSH promoter would be methylated when the plasmid is in vitro methylated and therefore could not be used for this experiment. To truncate CpGs within this region, site-directed mutagenesis primers were designed using the NEBaseChanger tool (New England Biolabs). Site-directed mutagenesis was performed using the Q5 site-directed mutagenesis kit (New England Biolabs; catalog no.: E0554S) following the manufacturer's protocol. pCpG-free-CTSH intron 1-lucia plasmids were transformed into the ChemiComp GT115 E. coli cells (Invivogen; catalog no.: gt115-11). Selected colonies were grown overnight for DNA extraction.
8
Cloning and Mutagenesis of CCR5 Receptor
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CCR5 in pcDNA3.1 Hygro(+) was created by PCR amplification of the coding region of N-terminally Flag-tagged CCR5 with subsequent subcloning of the product into pcDNA3.1 Hygro(+) under the CMV (human cytomegalovirus) promoter [185 ]. N-terminally Flag-tagged CCR2 in pcDNA3.1 was described in [186 (link)]. The CAMYEL biosensor in pcDNA was originally described in [187 (link)] and optimized for increased luminescence output by introducing two mutations (C124A/M185V) in the luciferase part in [188 ,189 ]. WT rat Gαi3 in pcDNA3.1 [189 ] was generously gifted by the Ghosh lab, UCSD. CCR5 mutants were generated in the pcDNA-Flag-CCR5 background using the Q5 site-directed mutagenesis kit and primers designed using the NEBaseChanger tool from New England Biolabs. Mutants were cloned and amplified in E. coli strain XL10 Gold.
9
Construction of EMCV Infectious Clones
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmids pEGFP-PI4KA (kindly provided by G. Hammond, NICHD, National Institutes of Health, Bethesda, MD, USA) (49 (link), 50 (link)), p3A-myc (CVB3) (51 (link)), and p3A-myc (EMCV) (26 (link)) were described previously. Plasmid pM16.1 contains the full-length infectious cDNA sequence of EMCV, strain mengovirus. Plasmid pRLuc-QG-M16.1 was obtained by introducing the Renilla luciferase gene upstream of the capsid coding region (52 (link)) in pM16.1. Infectious clones EMCV-3A-A32V and RLuc-EMCV-3A-A32V were generated by introducing the A32V mutation into the 3A sequence of pM16.1 and pRLuc-QG-M16.1, respectively, using mutagenesis primers designed with the NEBaseChanger tool and a Q5 site-directed mutagenesis kit (New England Biolabs) according to the manufacturer’s instructions. EMCV-3A-A34V and RLuc-EMCV-3A-A34V were generated as described for the 3A-A32V mutants. Constructs p3A-A32V-myc and p3A-A34V-myc were generated from p3A-myc (EMCV) using the same strategy. Subgenomic replicons pRib-LUC-CB3/T7 and pRib-LUC-CB3/T7-3A-H57Y, encoding Firefly luciferase in place of the capsid-coding region, were described previously (19 (link), 53 (link)).
10
Constructing Truncated Flatfish MSTN1 Prodomain
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To construct various truncated forms of flatfish MSTN1 prodomain (MSTNpro), we performed site-directed mutagenesis of an expression plasmid (pMAL-c5x-Pro45-80) using the Q5 site-directed mutagenesis kit (NEB, USA). The pMAL-c5x-Pro45-80 contains the flatfish MSTNpro cDNA fragment covering the amino acid sequence from 45 to 80 [36 (link)]. For site-directed mutagenesis, the primers (S1 Table ) were designed using NEBaseChanger tool (NEB, MA, USA). PCR products were treated with KLD enzymes (NEB, MA, USA) to remove the phosphorylated DNA terminus and methylated template DNA. After KLD reaction, the reactants were transformed into DH5a competent cells (Solgent, Seoul, Korea) by the heat shock method and spread on Luria-Bertani (LB) agar plate (1.0% tryptone, 0.5% yeast extract, 1.0% NaCl, 1.0% agar) containing 100 μg/mL ampicillin. Selected colonies were inoculated in 8 ml of LB medium containing 100 μg/mL ampicillin and incubated at 37 °C for overnight. Plasmids were extracted using a plasmid extraction kit (Solgent, Seoul, Korea) to confirm correct insertion by sequencing analysis (Solgent, Seoul, Korea).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!