Chemical compounds were purchased from Selleckchem (LY2603618), ThermoFisher Scientific (puromycin, doxycycline, and geneticin), and MedChemExpress (AZD1775, AZD6738, RO-3306, roscovitine, VX-970, NSC663284, and GDC-0575).
Doxycycline
Manufactured by MedChemExpress
Sourced in United States
Doxycycline is a broad-spectrum tetracycline antibiotic used in the laboratory setting. It functions as an inhibitor of bacterial protein synthesis.
Automatically generated - may contain errors
Lab products found in correlation
Doxycycline dox, by Merck Group (2 mentions)
Ap1903, by MedChemExpress (2 mentions)
Fugene hd, by Promega (2 mentions)
Opti mem, by Thermo Fisher Scientific (2 mentions)
Mg132, by MedChemExpress (2 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (2 mentions)
Puromycin, by MedChemExpress (1 mentions)
Azd6738, by MedChemExpress (1 mentions)
Roscovitine, by MedChemExpress (1 mentions)
Gdc 0575, by MedChemExpress (1 mentions)
Nsc663284, by MedChemExpress (1 mentions)
Ro 3306, by MedChemExpress (1 mentions)
Azd1775, by MedChemExpress (1 mentions)
Bovine serum, by Merck Group (1 mentions)
A1155463, by MedChemExpress (1 mentions)
Q vd oph, by Selleck Chemicals (1 mentions)
Abt 263, by MedChemExpress (1 mentions)
A 1331852, by MedChemExpress (1 mentions)
Rpmi 1640, by Thermo Fisher Scientific (1 mentions)
Lactic acid detection kit, by Nanjing Jiancheng (1 mentions)
16 protocols using doxycycline
1
Small Molecule Compound Purchases
2
Stable Transfection of HEK293T Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
U2OS cells (ATCC) and HEK293T landing pad cells [38 (link)] were propagated in Dulbecco´s Modified Eagle medium (DMEM), supplemented with 10% bovine serum (Sigma), 5000 IU/mL penicillin, 5 mg/mL streptomycin, 2 mM glutamine and, in the case of HEK293T landing pad cells, 2 μg/mL doxycycline (Dox) (Sigma-Aldrich, D9891), in a humidified atmosphere containing 5% CO2 at 37 °C. Transient transfections were performed with FugeneHD (Promega) in reduced serum medium OptiMEM (Gibco). To generate stable transfectants in the HEK293T landing pad cells, 106 cells in 1 mL DMEM without doxycycline were seeded into 12-well plates. On the next day, the cells were transfected using 0.1 μg of the integrase vector pNLS-Bxb1-recombinase, mixed with 0.4 μg of the pVAMP recombination plasmid, 40 μL OptiMEM and 1.6 μL FugeneHD. Two days after transfection, the cells were treated with 10 nM of AP1903 (MedChemExpress) and 2 μg/mL doxycycline for two days to select for recombinant cells. After another two days of culturing in media with doxycyclin, but without AP1903, the cells were used directly for western blotting, microscopy and flow cytometry.
3
Doxycycline treatment of HMC3 cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Doxycycline (Dox; MedChem Express, Monmouth Junction, USA) was dissolved in PBS at a concentration of 10 mM and stored at -80˚C. The storage solution was diluted to final concentration with PBS when needed. When the HMC3 cells reached 75% coverage, they were treated with 40 μM Dox (Matsumoto et al., 2017 (link)) for 6, 12 and 24 h. Another batch of HMC3 cells was exposed to Dox at various concentrations (20, 40, 80 and 160 µM) for 12 h (Alexander-Savino et al., 2016 (link)). Additionally, HMC3, HMC3-CALR and HMC3-sh-CALR cell lines were each treated with 160 µM Dox for 12 h, and the same concentration of Dox was also used to treat B. suis S2-infected HMC3 cells for 12 h.
4
Chemical Compounds for Cell Studies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
5
Inducible SOX1 Expression in HONE1 and CNE2 Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The HONE1 and CNE2 cell lines were obtained from Dr. Chao-Nan Qian (Sun Yat-sen University, Guangzhou, China). Wild type cell lines and their lentiviral-infected stable cell lines were all maintained in RPMI 1640 (Invitrogen) supplemented with 10% fetal bovine serum (FBS, Hyclone). The cells were incubated at 37 °C in a humidified chamber containing 5% CO2. HONE1-Tet-On-(X) and CNE2-Tet-On-(X) cell lines were treated with 2 μg/mL doxycycline (Medchem Express) to induce overexpression of SOX1 or its mutant/truncated form.
6
Antimicrobial Activity Assessment of Canagliflozin
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Canagliflozin was purchased from Hanxiang Biotechnology Co., Ltd., Shanghai, China. Penicillin V potassium was obtained from Sangon Biotech Co., Ltd., Shanghai, China. Doxycycline was obtained from MedChemExpress (https://www.medchemexpress.cn (accessed on 20 May 2023)). Nutrient broth medium powder (HB0108-4) and brain–heart extract liquid medium (HB8297-4) were obtained from Hope Bio-Technology Co., Ltd., Qingdao, China. Agar (AB0016H) was purchased from Sangon Biotech Co., Ltd., Shanghai, China. MRSA (ATCC43300) and MSSA (ATCC 6538) strains were obtained from Guangdong Microbial Culture Collection Center (GDMCC). The bacterial protein extraction kit (BC3750-50T) was obtained from Solarbio, Beijing, China. The PAGE Gel Fast Preparation Kit (PG113) was purchased from Epizyme Biomedical Technology Co., Shanghai, China. Brilliant Blue R250 (ST1123-25g) was purchased from Beyotime, Shanghai, China. The lactic acid detection kit was obtained from Jiancheng Bioengineering Institute, Nanjing, China. The glucose detection kit was purchased from Biosino Bio-Technology and Science Incorporation, Beijing, China. The ATP detection kit was purchased from Beyotime, Shanghai, China.
7
MYC Overexpression and GLS1 Knockdown
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To generate cells stably overexpress MYC, U266 and Loucy cell lines were transduced with EF1A-C-MYC (PLV-10010-50, Cellomics Technology, LLC) or EF1A-Vector Control lentivirus (PLV-10074-50, Cellomics Technology, LLC). Cells were plated at 50.000 cell per well and transduced over 8 hours at a multiplicity of infection (MOI) 10 in a growth media supplemented with 2 μg/mL Polybrene (Santa Cruz). After 72 hours, cells were selected in medium containing Puromycin (InvivoGen). Inducible lentiviruse short hairpin RNA (shRNA) encoding shRNA targeting GLS1 were purchased from FenicsBIO: shGLS1-1 (tet,Hyg): ATAGGATATTACTTAAAAGAAA; shGLS1-2 (tet,Hyg): TGCTAGACAAAGATCTTTTTAA; control shRNA (tet,Hyg) (SH-tet-C02). After 72 h, cells were selected in medium containing Hygromycin (InvivoGen). Doxycycline (MedChemExpress) was used to induce shRNA expression.
8
Oligodendrocyte Lineage Differentiation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For OL lineage differentiation, a two-step differentiation protocol was utilized. Specifically, expanded GANT61-NPCs were plated at 500,000 cells/well on poly-L-ornithine/laminin (Sigma-Aldrich, USA)-coated six-well plates. The day after passage, the culture medium was changed to GIM supplemented with doxycycline (1 μg/mL, Med Chem Express, USA). The GIM was changed every other day. After 4 days, the GIM was replaced with DM supplemented with the same components but lacking PDGF-AA and SAG, and the medium was changed every other day. For the GIM and DM detailed compositions used, see Supplementary Table S1 .
9
Establishment and Characterization of Hepatic Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Huh7, BEL7404, HeLa and HEK293T cells were obtained from Stem Cell Bank, Chinese Academy of Sciences, HepAD38 was provided by Prof. Shuping Tong of Fudan University. Stable NTCP-transfected HepG2 (HepG2-NTCP) was provided by Dr. Yongxiang Wang of Fudan University. The cell lines were maintained in Dulbecco's modified Eagle's medium (Gibco, Carlsbad, USA) supplemented with 10% fetal bovine serum (Gibco), 2 mmol/L l -glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin (Gibco) at 37 °C with 5% CO2. HepG2-NTCP was additionally supplemented with 2 μg/mL puromycin. For induction of Tet-on system, doxycycline (MedChemExpress, USA) was supplemented at 1 μg/mL or as indicated. DNA transfections were performed at cell confluence of 80%–90% with Turbofect transfection reagent (Thermo Fisher Scientific, Waltham, USA), according to the manufacturer's instructions. Fam-labeled control siRNA (sense, 5′-UUCUCCGA ACGUGUCACGUTT-3′; antisense, 5′-ACGUGACACGUUCGGAGAATT-3′) was chemically synthesized by GenePharma (Shanghai, China) and transfected using GP-transfect-Mate (GenePharma) according to manufacturer's instructions. Tenofovir disoproxil fumarate (TDF) was purchased from Selleck Chemicals (USA).
10
Molecular Mechanisms of DNA Damage Response
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Anti-MSI2 (#ab76148), anti-MSI1 (#ab21628), anti-phCHK2 T68 (#ab278548) were obtained from Abcam (Cambridge, UK). Anti-phATM S1981 (#GTX132146), anti-ATM (#GTX70103), anti-ATR (#GTX128146), anti-phCDC25A (#GTX55131), anti-CDC25A (#GTX102308) were obtained from GeneTex, Inc. (Irvine, CA). Anti-phH2A.X S139 (#9718), anti-ATM (#2873), anti-CHK2 (#2662), anti-phCHK1 S345 (#2348), anti-CHK1 (#2360), anti-β-actin (#3700), anti-rabbit HRP-linked (#7074), anti-mouse HRP-linked (#7076) were obtained from Cell signaling (Danvers, MA). Anti-MSI1 (#AF2628) was obtained from R&D systems (Minneapolis, MN) anti-ATM (#27156–1-AP) was obtained from Proteintech (Rosemont, IL). Olaparib (#HY-10162), cisplatin (#HY-17395), doxycycline (#HY-N0565) were obtained from MedChemExpress (Monmouth Junction, NJ).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!