Matchmaker gal4 two hybrid system 3 libraries user manual

Manufactured by Takara Bio

Sourced in United States

The Matchmaker GAL4 Two-Hybrid System 3 & Libraries User Manual provides instructions for a protein-protein interaction detection system. It enables the identification of interactions between a bait protein and prey proteins from a cDNA library. The manual details the system's components and protocols for the screening process.

Automatically generated - may contain errors

Lab products found in correlation

Yeast protocols handbook, by Takara Bio (2 mentions) Pgbkt7 yeast vector, by Takara Bio (1 mentions) Pgadt7, by Takara Bio (1 mentions) In fusion, by Takara Bio (1 mentions) Pgbkt7, by Takara Bio (1 mentions) O nitrophenyl β d galactopyranoside, by Avantor (1 mentions) O nitrophenyl β d galactopyranoside onpg, by Merck Group (1 mentions) Matchmaker gal4 two hybrid system 3, by Takara Bio (1 mentions)

Close spelling variants of this product

Matchmaker™ GAL4 Two-Hybrid System 3 & Libraries Matchmaker GAL4 Two-hybrid System 3 manual Matchmaker GAL4 Two-Hybrid System 3 GAL4 Two-hybrid System 3 manual Matchmaker GAL4 Two-Hybrid System Matchmaker GAL4 Two-Hybrid Matchmaker Two-Hybrid System 3 Matchmaker Two-Hybrid System GAL4 Two-Hybrid System Two-Hybrid System 3

7 protocols using matchmaker gal4 two hybrid system 3 libraries user manual

Yeast Two-Hybrid Screening for Clg2p Interactors

Check if the same lab product or an alternative is used in the 5 most similar protocols

Yeast two-hybrid (Y₂H) screening was performed using the Matchmaker™ GAL4 Two-Hybrid System 3 & Libraries User Manual (Clontech). First, the open reading frame (ORF) of Clg2p was amplified with primers 8F/R and inserted into the EcoRI and BamHI sites of the pGBKT7 yeast vector (Clontech) to create a bait. An AD fusion library in pGADT7-rescuing cDNA from C. lunata was constructed and transferred into the yeast strain AH109 as described in Jing et al.58 . The SD/-Ade/-His/-Leu/-Trp/X-α-Gal medium was used to screen and confirm expression. Then, plasmid DNA from the positive clones was isolated from yeast, transformed into E. coli and confirmed by sequencing.
Sequences from positive clones were analysed using BLASTx (http://www.ncbi.nlm.nih.gov). The predicted ORFs of positive colonies were extracted from the genome of C. lunata (http://www.ncbi.nlm.nih.gov/nuccore/JFHG00000000) and confirmed by RT-PCR with cDNA as a template. The percentage of similarity and identity of the known sequences were determined using the MatGAT programme. The conserved domains of the deduced proteins were analysed by CDD Search (http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) and Pfam (http://pfam.xfam.org/).

Liu T., Wang Y., Ma B., Hou J., Jin Y., Zhang Y., Ke X., Tai L., Zuo Y, & Dey K. (2016). Clg2p interacts with Clf and ClUrase to regulate appressorium formation, pathogenicity and conidial morphology in Curvularia lunata. Scientific Reports, 6, 24047.

+ Open protocol

+ Expand

Yeast Two-Hybrid Screening of MADS-Box Transcription Factors

Check if the same lab product or an alternative is used in the 5 most similar protocols

The full-length cDNAs of HvMADS3, HvMADS58, HvMADS13, HvMADS21, HvMADS1, HvMADS5, HvMADS34, HvMADS7, HvMADS8, and HvMADS6 were individually amplified with gene-specific primers from inflorescence cDNA (Supplemental Data Set 5). The amplified HvMADS8 sequence was then cloned into the prey activation domain (Ad) vector pGADT7; the other sequences were cloned into the bait DNA-binding domain (BD) vector pGBKT7 (Clontech), using the In-Fusion (Takara) cloning technology at the EcoRI and BamHI sites. These constructs were transformed using one-step buffer (0.1 m dithiothreitol; 0.3 m lithium acetate and 40% [w/v] polyethylene glycol 4000) followed by a 30-min incubation at 45 °C into yeast (Saccharomyces cerevisiae) strain AH109 (BD Biosciences, USA), and the yeast 2-hybrid assay was performed according to the MATCHMAKER GAL4 Two-Hybrid System 3 & Libraries User Manual (Clontech). Yeast transformants were selected on SD medium lacking Leu and Trp (SD/–Leu/–Trp, SD–2). Protein interactions were tested, with no detectable self-activation for each of the single constructs on SD medium with high stringency (SD–Ade/–His/–Leu/–Trp, SD–4). To compare interactions at different temperatures, transformants grown on SD–2 medium were used as a reference. Transformants containing empty plasmids pGADT7 (prey) and pGBKT7 (bait) were used as negative controls.

Shen C., Zhang Y., Li G., Shi J., Wang D., Zhu W., Yang X., Dreni L., Tucker M.R, & Zhang D. (2023). MADS8 is indispensable for female reproductive development at high ambient temperatures in cereal crops. The Plant Cell, 36(1), 65-84.

+ Open protocol

+ Expand

Yeast Two-Hybrid Assay Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Y2H assays were performed as described previously (31 (link)). The pDEST-GBKT7–based bait vectors were transformed into the yeast strain Y187, and the yeast strain AH109 was transformed with pDEST-GADT7–based vectors. The fresh diploids by yeast mating were used to detect protein-protein interactions on selective triple dropout media (without Leu, Trp, and His) plus 1 mM 3-aminotriazole and quadruple dropout medium (without Leu, Trp, His, and Ade).
For yeast monohybrid assays (45 (link)), pDEST-GBKT7–based GAL4 DNA-BD fusion vectors were transformed into the yeast strain AH109 including several reporters (HIS3, MEL1, and lacZ) under distinct GAL4 upstream activating sequences as described in Matchmaker GAL4 Two-Hybrid System 3 & Libraries User Manual (Clontech). The transformants were grown on synthetic dropout agar medium lacking Trp and His (−WH) and detected on synthetic dropout/−WH/X-α-Gal (Biosynth). The liquid cultures of yeast cells were used to detect the lacZ expression in quantitative β-galactosidase assays with o-nitrophenyl-β-d-galactopyranoside (Amresco) performed according to the Yeast Protocols Handbook (Clontech).

Chen H., Li M., Qi G., Zhao M., Liu L., Zhang J., Chen G., Wang D., Liu F, & Fu Z.Q. (2021). Two interacting transcriptional coactivators cooperatively control plant immune responses. Science Advances, 7(45), eabl7173.

+ Open protocol

+ Expand

Yeast Two-Hybrid Screening of Arabidopsis Seedlings

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Y2H screening of cDNA library derived from 9-day-old seedlings of Arabidopsis was performed following the manufacturer’s instructions (Matchmaker GAL4 Two-Hybrid System 3 & Libraries User Manual Clontech Laboratories). We conducted a Y2H assay. Briefly, the bait plasmid, pGBKT7, or prey plasmid, pGADT7, with full-length or truncated LFR or SWI3B were co-transformed into AH109. The co-transformed colonies were selected to grow on a selective medium that lacked leucine and tryptophan (SD/-L-W). A growth assay was then conducted, in which the physical interaction between different pair of proteins was tested on selective medium that lacked leucine, tryptophan, adenine, and histidine (SD/-L-W-A-H). Liquid β-galactosidase (β-Gal) assays, with o-nitrophenyl β-D-galactopyranoside (ONPG) (Sigma) as a substrate, were measured as described in the manufacture’s handbook (Clontech Yeast Protocols Handbook). One unit of β-galactosidase activity was defined as the amount in which hydrolysis of 1 μ mol of ONPG to o-nitrophenol and D-galactose per min per cell occurred.

Lin X., Yuan C., Zhu B., Yuan T., Li X., Yuan S., Cui S, & Zhao H. (2021). LFR Physically and Genetically Interacts With SWI/SNF Component SWI3B to Regulate Leaf Blade Development in Arabidopsis. Frontiers in Plant Science, 12, 717649.

+ Open protocol

+ Expand

Yeast Two-Hybrid Screening of StMKK1

Check if the same lab product or an alternative is used in the 5 most similar protocols

The BD plasmid pGBKT7:StMKK1 was transformed into Saccharomyces cerevisiae strain Y187, and yeast two‐hybrid (Y2H) screenings were performed according to the protocol described in the Matchmaker™ GAL4 Two‐Hybrid System 3 & Libraries User Manual (Clontech). For one‐to‐one Y2H assays, the BD vector pGBKT7 was co‐transformed with the AD vector pGADT7 into the yeast strain AH109. Interaction was confirmed by growing the yeast transformants on QDO (selective drop‐out/−Trp‐Leu‐His‐Ade) medium. Positive and negative interaction controls were provided by the Matchmaker™ GAL4 Two‐Hybrid System 3 (Clontech).

Li F., Chen X., Yang R., Zhang K., Shan W., Joosten M.H, & Du Y. (2023). Potato protein tyrosine phosphatase StPTP1a is activated by StMKK1 to negatively regulate plant immunity. Plant Biotechnology Journal, 21(3), 646-661.

+ Open protocol

+ Expand

Yeast Two-Hybrid Screening for OSIC1 Interactors

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Y2H screening was performed according to the Matchmaker GAL4 Two‐hybrid system 3 & Libraries User Manual (TaKaRa). The cDNA library of P. alba var. pyramidalis was customized using the Clontech kit (TaKaRa). The CDS of OSIC1 was ligated onto the pGBKT7 vector to generate the BD‐OSIC1 construct as the bait. The bait plasmid was first introduced into the AH109 yeast strain, and then, the transformants were transformed with the cDNA library according to the manufacturer's manual (Clontech). These transformed yeasts were screened on the SD lacking W, L and H, containing 30 mm 3‐AT. These screened yeast clones were subjected to PCR with primers (T7: TAATACGACTCACTATAGGGC; 3′AD AGATGGTGCACATGCACAG), and then, the PCR products were identified by sequencing.
For point‐to‐point Y2H, the CDSs of OSIC1 and PalMPK3 were ligated into pGADT7 and pGBKT7, respectively. These constructs were cointroduced into the AH109 yeast strain and the interaction was screened on SD medium lacking W, L and H, containing 30 mm 3‐AT. The vector combinations AD + BD, AD + BD‐PalMPK3, AD + BD‐OSIC1 and AD‐OSIC1 + BD were used as the negative controls. The combination AD‐SOS2 (GenBank: XM_011019470.1) + BD‐SOS3 (GenBank: XM_011016039.1) served as the positive control. α‐Gal was used to stain the positive transformants.

Bai Q., Niu Z., Chen Q., Gao C., Zhu M., Bai J., Liu M., He L., Liu J., Jiang Y, & Wan D. (2023). The C2H2‐type zinc finger transcription factor OSIC1 positively regulates stomatal closure under osmotic stress in poplar. Plant Biotechnology Journal, 21(5), 943-960.

+ Open protocol

+ Expand

Yeast Two-Hybrid Screening of P. alba var. pyramidalis

Check if the same lab product or an alternative is used in the 5 most similar protocols

The CDS of genes of interest were cloned and ligated to pGBKT7 and pGADT7 vectors. The constructed bait and prey plasmids were then co‐transformed into the yeast strain AH109 by the PEG/LiAc method (Gietz and Schiestl, 2007 (link)). The positive transformants were screened using synthetic dropout (SD) medium without tryptophan (W), leucine (L) and histidine (H). The yeast two‐hybrid screening was performed according to Matchmaker GAL4 Two‐hybrid system 3 & Libraries User Manual (TaKaRa). The cDNA library of P. alba var. pyramidalis was customized using the Clontech kit (TaKaRa).

Tong S., Chen N., Wang D., Ai F., Liu B., Ren L., Chen Y., Zhang J., Lou S., Liu H., Liu J., Ma T, & Jiang Y. (2021). The U‐box E3 ubiquitin ligase PalPUB79 positively regulates ABA‐dependent drought tolerance via ubiquitination of PalWRKY77 in Populus. Plant Biotechnology Journal, 19(12), 2561-2575.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!