Genotyping of cord blood samples for FcγRIIb alleles was done as described before (Baerenwaldt et al., 2011 (link)). In brief, genomic DNA was isolated with the „QiaAmp DSP Blood Mini Kit “(Qiagen, Hilden) following the instructions of distributor. FcγRIIB genotyping was carried out with a two-step PCR protocol. Briefly, a 15 kb product was amplified using the Qiagen ‘LongRange PCR Kit’ (Qiagen) (Primers LongRange fwd: ctccacaggttactcgtttctaccttatcttac and LongRange rev: gcttgcgtggcccctggttctca ) generating a 14.7 kb amplicon which was purified via gel electrophoresis and by using the Qiagen ‘Gel purification Kit’. This PCR product was used as a template for the nested PCR to amplify the transmembrane region (Primers R2Btm-fwd: aaggggagcccttccctctgtt and R2Btm-rev: gtggcccctggttctcagaa ). Subsequently, the PCR product (2365 bp) was gel purified and sequenced (using the R2Bseq primer: aaggggagcccttccctctgtt ).
Qiaamp dsp blood mini kit
Manufactured by Qiagen
The QiaAmp DSP Blood Mini Kit is a laboratory equipment product designed for the purification of DNA from small volumes of whole blood samples. It utilizes a silica-based membrane technology to efficiently extract and concentrate DNA, which can then be used for various downstream applications.
Automatically generated - may contain errors
Lab products found in correlation
2 protocols using qiaamp dsp blood mini kit
1
FcγRIIb Genotyping from Cord Blood
2
Genotyping of FcγRIIb alleles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genotyping of blood samples for FcγRIIb alleles was done as described before [14 (link)]. Briefly, genomic DNA was isolated with the „QiaAmp DSP Blood Mini Kit “(Qiagen, Hilden) according to the manufactureŕs instructions. For FcγRIIb genotyping a two-step PCR protocol was followed: Firstly, a 15 kb product was amplified using the Qiagen ‘LongRange PCR Kit’ (Qiagen) (Primers LongRange fwd: ctccacaggttactcgtttctaccttatcttac and LongRange rev: gcttgcgtggcccctggttctca) generating a 14.7 kb amplicon. Following purification by gel electrophoresis with the Qiagen ‘Gel purification Kit’, the PCR product was used as a template for the nested PCR (Primers R2Btm-fwd: aaggggagcccttccctctgtt and R2Btm-rev: gtggcccctggttctcagaa). Finally, the PCR product (2365 bp) containing the transmembrane region was purified and sequenced (using the R2Bseq primer: aaggggagcccttccctctgtt).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!