Recombinant il 7

Manufactured by Thermo Fisher Scientific

Sourced in United States

Recombinant IL-7 is a cytokine produced using recombinant DNA technology. It is a protein involved in the differentiation and proliferation of T cells and B cells.

Automatically generated - may contain errors

Lab products found in correlation

Spelling variants of this product

Recombinant human IL-7 (33 citations) Recombinant mouse IL-7 (29 citations) Recombinant murine IL-7 (28 citations) Recombinant human IL-7 and IL-15 (4 citations) Recombinant mouse IL-7 and IL-15 (2 citations)

12 protocols using recombinant il 7

T Cell Stability Assay with RORgt+ CD4+ T Cells and ILC3s

Check if the same lab product or an alternative is used in the 5 most similar protocols

T cell stability assay was conducted as previously
reported^{70 (link)} with
minor modifications. Sort-purified RORγt⁺ CD4⁺T cells
(CD45⁺RORγtGFP⁺CD5⁺CD3⁺CD4⁺)
and ILC3s
(CD45⁺RORγtGFP⁺CD3⁻CD5⁻CD19⁻B220⁻TCRγδ⁻Gr1⁻NK1.1⁻CD11b⁻CD11c⁻CD127⁺CCR6⁺)
were plated in a round-bottom 96-well plate at a 1:1 or 2:1 ratio (10⁴ to
10⁵ cells per well). In some experiments, technical replicates were
necessarily used instead of biological replicates when cell numbers were
limited. No statistical analyses were made when using technical replicates.
Large intestine and mLN were used to collect RORγt⁺CD4⁺ T cells and ILC3s. Cells were incubated in RPMI,
supplemented with 10% FBS, 1 mM Sodium Pyruvate, 10 mM HEPES, 2 mM GlutaMax,
80 μM 2-mercaptoethanol, 100 U/mL penicillin, 100 μg/mL
streptomycin (all from Thermo Fisher Scientific), 10 ng/mL recombinant IL-7
(Thermo Fisher Scientific), anti-integrin αV (Biolegend),
anti-integrin β1 (BD Biosciences), anti-integrin β3 (BD
Biosciences) and anti-integrin αVβ6 (MilliporeSigma) at 10
μg/mL at 37°C and 5% CO₂ for 72 hours. Cells were
analyzed by flow cytometry.

Lyu M., Suzuki H., Kang L., Gaspal F., Zhou W., Goc J., Zhou L., Zhou J., Zhang W., Shen Z., Fox J.G., Sockolow R.E., Laufer T.M., Fan Y., Eberl G., Withers D.R, & Sonnenberg G.F. (2022). ILC3s select microbiota-specific regulatory T cells to establish tolerance in the gut. Nature, 610(7933), 744-751.

+ Open protocol

+ Expand

Freeze-drying Recombinant IL-7 for QFT

Check if the same lab product or an alternative is used in the 5 most similar protocols

Under sterile conditions, caps were removed from QFT nil and antigen tube (Qiagen, DE) and recombinant IL-7 (Thermo Fisher Scientific, Waltham, MA, USA) diluted in sterile water to a final concentration of 1μg/ml was added in a 2μl droplet to the side of the tube[18 (link)]. Tubes were covered with sterile tin foil, frozen at -80°C for 24h before freeze drying. Following, tubes were recapped and kept in plastic zipper bags with desiccant and stored for 4°C until use. On day of use, vacuum sufficient for 1ml blood draw was created using a syringe and needle as described elsewhere (19).

Hiza H., Fenner L., Hella J., Kuchaka D., Sasamalo M., Blauenfeldt T., Kibiki G., Kavishe R.A., Mhimbira F, & Ruhwald M. (2018). Boosting effect of IL-7 in interferon gamma release assays to diagnose Mycobacterium tuberculosis infection. PLoS ONE, 13(8), e0202525.

+ Open protocol

+ Expand

In Vitro T Cell Proliferation Assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells from lymph nodes or spleens were cultured in IMDM medium supplemented with heat-inactivated 10% FBS, 2 mM L-glutamine, 100 U/mL Penicillin, 100 mg/mL Streptomycin and 50 μM 2-mercaptoethanol (all Sigma-Aldrich). For in vitro cell proliferation assays cells were labeled with 500 nM CellTracer Violet (Life Technologies). N4, T4, and G4 peptides (Peptide Synthetics) were added to culture medium at indicated concentrations. Recombinant IL-7 (Peprotech) was used at 20 ng/mL, recombinant IL-10 (Peprotech) was used at indicated concentrations. For cytokine recall responses cells were restimulated with 20 ng/mL phorbol 12,13-dibutyrate (PdBU) and 0.5 μg/mL Ionomycin (all Sigma-Aldrich) in presence of 1 μg/ml Brefeldin A for 4 h before intracellular staining (antibodies identified above). Transgenic OT-1 T cells were restimulated with T4 peptide (SIITFEKL) in presence of 1 μg/ml brefeldin A for 4 h. Where stated cells were stimulated in media with 0.5 μg/mL anti CD3ε antibody and 2 μg/mL anti CD28 antibody (both BioLegend) for 4 h.

Knipper J.A., Wright D., Cope A.P., Malissen B, & Zamoyska R. (2020). PTPN22 Acts in a Cell Intrinsic Manner to Restrict the Proliferation and Differentiation of T Cells Following Antibody Lymphodepletion. Frontiers in Immunology, 11, 52.

+ Open protocol

+ Expand

IL-7 Stimulation of T Cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

T cells were stimulated with IL-7 as previously described (7 (link)). In brief, single cell suspensions were adjusted to 5 × 10⁶ cells/ml and stimulated with recombinant IL-7 (PeproTech) at 37 C for the indicated time. pSTAT5 contents were assessed after 30 min upon fixing and permeating cells with paraformaldehyde and acetone/methanol, followed by staining with anti-pSTAT5-specific monoclonal antibodies (clone 47, BD Bioscience).

Kim H.K., Chung H., Kwon J., Castro E., Johns C., Hawk N.V., Hwang S., Park J.H, & Gress R.E. (2019). Differential Cytokine Utilization and Tissue Tropism Results in Distinct Repopulation Kinetics of Naïve vs. Memory T Cells in Mice. Frontiers in Immunology, 10, 355.

+ Open protocol

+ Expand

Long-Term PBMC Expansion and Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols

Freshly isolated or thawed PBMCs were stimulated with LPP or 15mP (200 ng/mL) in 24‐well plates and incubated for 7–14 days at 37°C in 5% CO₂ before performing phenotypic and functional assays. Recombinant human IL‐2 (20 U/mL; Peprotech, Rocky Hill, NJ) and recombinant IL‐7 (5 ng/mL; Peprotech) were added once a week.

Cioni M., Leboeuf C., Comoli P., Ginevri F, & Hirsch H.H. (2016). Characterization of Immunodominant BK Polyomavirus 9mer Epitope T Cell Responses. American Journal of Transplantation, 16(4), 1193-1206.

+ Open protocol

+ Expand

Isolation and Activation of Murine ILC2s

Check if the same lab product or an alternative is used in the 5 most similar protocols

Ten- to 12-week-old B10.BR and BALB/c mice were given 0.4 µg of recombinant mouse IL-17E/IL-25 (R&D Systems, Minneapolis, MN) for 4 days. On day 5, cells were isolated from mesenteric lymph nodes and peritoneum by peritoneal lavage using RPMI with 10% fetal bovine serum (complete media). ILC2s were isolated by negative selection with a MACs column using biotinylated antibodies [anti-CD8α (53-6.7), anti-CD4 (RM 4.4), anti-CD3ε (145-2C11), anti-γδTCR (UC7-13DS), anti-TER119 (TER-119), anti-B220 (RA3-6B2), anti-CD11b (M1/70), and anti-NK1.1 (PK136) (all; eBioscience, San Diego, CA); anti-CD11c (N418), anti-CD19 (MB19-1), anti-Ly6G (1A8), and anti-CD49b (DX5) (all; BioLegend, San Diego, CA); and Streptavidin Microbeads (130-048-101; Miltenyi Biotec, Cambridge, MA)]. Cells were cultured for 6 days in complete media with recombinant IL-7 and recombinant IL-33 (10 ng/mL) (PeproTech, Rocky Hill, NJ), changing the media every 2 days. ILC2 activation was evaluated by using flow cytometry on day 6 by intracellular cytokine staining of lineage-specific markers, ST2, KLRG1, and expression of IL-13. For steroid response assays, dexamethasone (10 nM) (D4902; MilliporeSigma, Burlington, MA) was added to ILC2 cultures on day 4 and evaluated 48 hours later.

Bruce D.W., Kolupaev O., Laurie S.J., Bommiasamy H., Stefanski H., Blazar B.R., Coghill J.M, & Serody J.S. (2021). Third-party type 2 innate lymphoid cells prevent and treat GI tract GvHD. Blood Advances, 5(22), 4578-4589.

+ Open protocol

+ Expand

IL-7 Stimulation of T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

T cells were stimulated with IL-7 as previously described [17 (link)]. In brief, single cell suspensions were adjusted to 5 × 10⁶ cells/mL and stimulated with recombinant IL-7 (PeproTech). pSTAT5 contents were assessed after 30 min upon fixing and permeating cells with paraformaldehyde and acetone/methanol. Alternatively, cells were stimulated for 4 h with IL-7 (10 ng/mL), then removed from IL-7 by extensive washing, rested for 2 h in IL-7-free medium and restimulated with IL-7.

Kim H.K., Waickman A.T., Castro E., Flomerfelt F.A., Hawk N.V., Kapoor V., Telford W.G, & Gress R.E. (2016). Distinct IL-7 signaling in recent thymic emigrants versus mature naïve T cells controls T-cell homeostasis. European journal of immunology, 46(7), 1669-1680.

+ Open protocol

+ Expand

Electroporation of Cas9 RNPs in Naive T cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

GGTAGAGTCGCGAACGCTAC;
GATGCGGACCCACGTTAAGC;
GGCATGGAGTCAACGTCCGC
Guides targeting both Zfp36 and Zfp36l1GAGCGGGCGTTGTCGCTACG + GGAGTGACCGAGTGCCTGCG;
GAGCGGGCGTTGTCGCTACG + GTTGAGCATCTTGTTACCCT;
GATGACCTGTCATCCGACCA + GTTGAGCATCTTGTTACCCT;
For electroporation of Cas9 Ribonucleoproteins naïve OT-I T cells were isolated using the StemCell EasySep Mouse Naïve CD8⁺ T Cell Isolation Kit (StemCell; 19853). Isolated cells were electroporated with complexes of Cas9 and control or IL2 targeting gRNA (all from IDT) in OptiMEM medium (Gibco) using the NEPA21 electroporator (Nepagene). After electroporation cells were cultured for 24 h in RPMI medium (Gibco) containing 10% FCS and 10 ng/ml recombinant IL7 (Peprotech; 217-17), before transfer into recipient mice. The following guide sequence (IDT) was used to target the the indicated genomic sequence of the Il2 gene: AAGATGAACTTGGACCTCTG.

Petkau G., Mitchell T.J., Chakraborty K., Bell S.E., D´Angeli V., Matheson L., Turner D.J., Saveliev A., Gizlenci O., Salerno F., Katsikis P.D, & Turner M. (2022). The timing of differentiation and potency of CD8 effector function is set by RNA binding proteins. Nature Communications, 13, 2274.

+ Open protocol

+ Expand

Kinetic Analysis of Signaling Modulators in HPB-ALL Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Exponentially growing HPB-ALL cells were washed and seeded in 6-well cell culture plates as 2 × 10⁶ cells/mL using serum-free RPMI (hereafter referred to as R0). Then, selected concentrations of CIGB-300, CX-4945, or F20-2 negative control peptide were added in dose-response experiments for 2 h or incubated during 0.5, 2, 6, 12, and 24 h in kinetic experiments. In some experiments the selective PI3K inhibitor LY294002 (10 µM; Calbiochem, San Diego, CA, USA) was used. Signaling experiments on TAIL7 cells were conducted after starving the cells during 24 h in RPMI with 1% FBS (Invitrogen, Carlsbad, CA, USA). Subsequently, cells were washed, resuspended as 2 × 10⁶ cells/mL in RPMI with 5% FBS, and incubated with CIGB-300 (18 µM) or CX-4945 (12 µM) for 1 h. In selected experiments, 15 min after addition of the drugs, 20 ng/mL of recombinant IL-7 (Peprotech, Rocky Hill, NJ, USA) were added and incubated for 45 min. Finally, signaling experiments on IL-7-responsive HPB-ALL cells were conducted on RPMI with 1% FBS (R1) after 24 h starvation by adding recombinant IL-7 up to a final concentration of 50 ng/mL.

Perera Y., Melão A., Ramón A.C., Vázquez D., Ribeiro D., Perea S.E, & Barata J.T. (2020). Clinical-Grade Peptide-Based Inhibition of CK2 Blocks Viability and Proliferation of T-ALL Cells and Counteracts IL-7 Stimulation and Stromal Support. Cancers, 12(6), 1377.

+ Open protocol

+ Expand

Generating CD19- and GD2-targeting CAR-T cells

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Peripheral blood mononuclear cells (PBMCs) derived from healthy donors (Cellular Technology Limited, Cleveland, OH) were stimulated with mitomycin C-treated K562 cells (JCRB, Osaka, Japan) expressing anti-CD3 mAb (clone OKT3)-derived single-chain variable fragment (scFv) and CD80 on the cell surface at an effector to target ratio of 7:1 (4 (link)). Stimulated T cells were cultured with RPMI-1640 medium containing 10% fetal bovine serum, 1% penicillin/streptomycin, and recombinant IL-2 (100 IU/ml, Nipro, Osaka, Japan). Unstimulated T cells were maintained in the presence of recombinant IL-7 (10 ng/ml, PeproTech, Waltham, MA). When indicated, naïve T cells were enriched by magnetically isolating CD45RO⁻ cells using CD45RO MicroBeads (Miltenyi Biotech, Bergisch Gladbach, Germany).
To generate CAR-T cells, T cells were retrovirally transduced with CD19- or GD2-targeting CAR genes two days after stimulation. We used PG13 packaging cells for retrovirus production. The CAR constructs consisted of a single-chain variable fragment (scFv) derived from the clone FMC63 (targeting CD19) (24 (link)) or 14g2a with E101K high-affinity mutation (targeting GD2) (25 (link)) linked to CD28 and CD3z signaling domains.

Ito Y., Inoue S., Nakashima T., Zhang H., Li Y., Kasuya H., Matsukawa T., Wu Z., Yoshikawa T., Kataoka M., Ishikawa T, & Kagoya Y. (2023). Epigenetic profiles guide improved CRISPR/Cas9-mediated gene knockout in human T cells. Nucleic Acids Research, 52(1), 141-153.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!