Mastercycler ep gradient s thermocycler

Manufactured by Eppendorf

Sourced in Germany

The Mastercycler ep gradient S is a thermocycler designed for DNA amplification. It features a gradient function that allows for the optimization of PCR conditions across multiple samples.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Mastercycler® ep Gradient S realplex® thermocycler Mastercycler EP gradient thermocycler Mastercycler ep gradient S Ep gradient S thermocycler Mastercycler ep gradient Mastercycler gradient thermocycler Mastercycler ep Mastercycler thermocycler Mastercycler Gradient Gradient thermocycler

10 protocols using mastercycler ep gradient s thermocycler

Blastocystis SSU-rDNA Amplification Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted from approximately 200 mg of frozen fecal samples using a commercial QIAamp Stool Mini Kit (QIAGEN, Hilden, Germany), according to the manufacturer's instructions.
PCR amplification was performed using Blastocystis-specific SSU-rDNA primers RD5 (5′-ATCTGGTTGATCCTGCCAGT-3′) and BhRDr (5′-GAGCTTTTTAACTGC AACAACG-3′) described by Scicluna et al. (2006) (link). PCR reactions were performed in a 10 μL volume containing ∼50 ng μL⁻¹ of DNA, 2.0 μg BSA, 0.2 mM each dNTP, 1.5 mM MgCl₂, 2pM of each primer, 1 × PCR buffer and 1.25 U GoTaq® DNA Polymerase (Promega Corporation, Madison, USA). PCR conditions consisted of an initial denaturation cycle at 94 °C for 2 min, 30 cycles including denaturation at 94 °C for 1 min, annealing 61.8 °C for 1 min, extension at 72 °C for 1 min and final extension at 72 °C for 2 min. PCR amplification was conducted with a Mastercycler EP Gradient S Thermocycler (Eppendorf, Hamburg, Germany). The products were separated by electrophoresis in 2% agarose gel containing Sybr Safe (Invitrogen™, Thermo Fisher Scientific Corporation, Waltham, MA, USA) with a size marker of 100bp.

Melo G.B., Malta F.D., Maruta C.W., Criado P.R., Castilho V.L., Gonçalves E.M., Espirito-Santo M.C., Paula F.M, & Gryschek R.C. (2019). Characterization of subtypes of Blastocystis sp. isolated from patients with urticaria, São Paulo, Brazil. Parasite Epidemiology and Control, 7, e00124.

+ Open protocol

+ Expand

Quantitative analysis of HDAC2 and NF-kB p65 expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from lung tissues with TRIzol reagent (Invitrogen, USA)
according to the manufacturer's protocol. Reverse transcription (RT) was performed
with oligo (dT) primer using the RevertAid^™ First Strand cDNA Synthesis
Kit (Fermentas, China). PCR primer sequences included the following: HDAC2,
5′-CGGTGGCTCAGTTGCTGGGG-3′(sense) and 5′-TGCAGTCCTCCCGCCCAGTT-3′ (antisense); NF-κB p65, 5′-GACGAGGCTCGGAGAGCCCA-3′ (sense) and
5′-CTGGGGCGGCTGACCGAATG-3′(antisense); and glyceraldehyde 3-phosphate dehydrogenase (GAPDH), 5′-CAAGTTCAACGGCACAGTCAAGG-3′ (sense) and
5′-ACATACTCAGCACCAGCATCACC-3′(antisense). The predicted sizes of the PCR products were 78 bp for HDAC2, 145 bp for
NF-κB p65, and 123 bp for GAPDH. The 50-µL PCR reactions consisted of 0.5 µL of each
primer, 32.5 µL SYBRGreen Mix, 14.5 µL ddH₂O, and 2 µL cDNA. qRT-PCR was
performed in triplicate with a Mastercycler ep gradient S thermocycler (Eppendorf,
Germany). The resulting product of each sample was normalized to that of GAPDH
transcripts. The quantitative analysis was carried out using the ΔΔCT method.

Zhou Y., Wang G.F., Yang L., Liu F., Kang J.Q., Wang R.L., Gu W, & Wang C.Y. (2015). Treatment with 1,25(OH)2D3induced HDAC2 expression and reduced NF-κB p65 expression in a rat model of OVA-induced asthma. Brazilian Journal of Medical and Biological Research, 48(7), 654-664.

+ Open protocol

+ Expand

Multiplex PCR for Mitochondrial Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Each reaction contained 3 μL DNA template, 5 μL QIAGEN Multiplex PCR Master Mix (Qiagen, Germany) (including Taq polymerase, dNTPs and MgCl2), 0.5 μM forward primer, 0.5 μM reverse primer and 1 μL molecular biology grade water in a total volume of 10 μL. PCR conditions were 95 °C for 15 min; 35 cycles of 94 °C for 30 sec, 51 °C for 90 sec and 72 °C for 60 sec; and a final extension at 72 °C for 10 min. All amplifications were completed on an Eppendorf Master cycle rep gradient S thermocycler (Eppendorf, Germany). The same primers as for the Sanger data set were used. Two primer pairs for COI: LCO1490puc + HCO2198puc45 (“COI-long”, Table 1) and UEA356 + HCO219857 (“COI-short”); one pair for Cytb: CB1 + CB258 (link) and one pair for EF1a: F2-557F + F2-1118R59 (link). Thus, four amplicons were generated per specimens. Amplicons were visualized on 1% agarose gels stained after electrophoresis using ethidium bromide to quantify PCR success.

Cruaud P., Rasplus J.Y., Rodriguez L.J, & Cruaud A. (2017). High-throughput sequencing of multiple amplicons for barcoding and integrative taxonomy. Scientific Reports, 7, 41948.

+ Open protocol

+ Expand

Extraction and Sequencing of Blood RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was extracted from the patient’s blood using the PAXgene Blood RNA Kit (PreAnalytiX GmbH, Hombrechtikon, Switzerland). Reverse transcription was performed on 200 ng of RNA using the BioRad iScript cDNA^® Synthesis Kit (BioRad, Hercules, CA, United States). PCR was performed on the cDNA using the Mastercycler ep. Gradient S thermocycler (Eppendorf, Germany). Specific fragment analysis was done by cutting the agarose gel around the fragment of interest (e.g., F3) and eluted in Tris–EDTA buffer 10.1 overnight. The elution product (5 μL) was reamplified by PCR using the same conditions to obtain a unique fragment. Bidirectional sequencing of the purified PCR products was performed by the GATC Sequencing Facilities (Konstanz, Germany). Primers used are summarized in Supplementary Table S2.

Schaefer E., Delvallée C., Mary L., Stoetzel C., Geoffroy V., Marks-Delesalle C., Holder-Espinasse M., Ghoumid J., Dollfus H, & Muller J. (2019). Identification and Characterization of Known Biallelic Mutations in the IFT27 (BBS19) Gene in a Novel Family With Bardet-Biedl Syndrome. Frontiers in Genetics, 10, 21.

+ Open protocol

+ Expand

Amplification of kDNA Minicircle Fragment

Check if the same lab product or an alternative is used in the 5 most similar protocols

The PCR protocol was used to amplify a fragment of 145 bp present on the highly multicopy kDNA minicircles employing RV1(5‐ CTTTTCTGGTCCCGCGGGTAGG‐3) and RV2(5‐CCACCTGGCCTATTTTACACCA‐3) primers as previously described by Lachaud et al. (2001 (link)). PCR reactions were carried out in a 25 μl reaction mixture, including 1 μl of template DNA,
25 pmol of each primer and 12.5 μl of PCR premix (2× Master Mix RED; Ampliqon, Denmark). The kDNA amplification was performed with 4 min of initial denaturation at 94°C, and 30 cycles of 30 s denaturation at 94°C, 30 s annealing at 58°C and 30 s elongation at 72°C followed by a final extension at 72°C for 5 min. All PCR in the present study was conducted using a Mastercycler ep Gradient S thermocycler (Eppendorf, Hamburg, Germany) and negative (no‐DNA) and positive controls were included for each PCR set.

Fakhar M., Derakhshani‐nia M., Gohardehi S., Karamian M., Hezarjaribi H.Z., Mohebali M., Akhoundi B, & Sharbatkhori M. (2022). Domestic dogs carriers of Leishmania infantum, Leishmania tropica and Crithidia fasciculata as potential reservoirs for human visceral leishmaniasis in northeastern Iran. Veterinary Medicine and Science, 8(6), 2329-2336.

+ Open protocol

+ Expand

Quantitative Analysis of miRNA in Cellular and Exosomal Samples

Check if the same lab product or an alternative is used in the 5 most similar protocols

TaqMan RT-qPCR of synthetic miRNAs, MCF-7 total RNA, A549 whole cell lysate, and cell-derived exosomes was conducted in parallel to the MERCA. A549 whole cell lysate was diluted with the lysis buffer by 10 and 100 folds prior to RNA extraction. Lyophilized exosome standards (100 μg) were disrupted by adding 300 μL lysis buffer. Total RNA was then extracted from the cell and exosome lysates with the mirVana™ miRNA Isolation Kit, following the manufacturer’s protocol with slight change. The RNA extract was stored at -80 ºC until use. Purified total RNA was reverse-transcribed into cDNAs using the TaqMan MicroRNA Reverse Transcription Kit (ThermoFisher Scientific) following the manufacturer’s instruction. Each 15-μL RT reaction consists of 7 μL master mix, 3 μL of 5× RT primer, and 5 μL RNA sample. 1.33 μl of 15-fold diluted RT reaction product was mixed with 1 μl pre-formulated primer and probe set for let-7a (Applied Biosystems™ TaqMan™ MicroRNA Assays, 20×), 10 μl TaqMan® Universal PCR Master Mix II (2×), 7.67 μl nuclease-free water to prepare 20 μl PCR reactions. qPCR was conducted on a Mastercycler EP Gradient S thermocycler (Eppendorf) using a hot-start protocol: 95 °C for 10 min followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. All reactions were run in triplicate.

Cao H., Zhou X, & Zeng Y. (2018). Microfluidic Exponential Rolling Circle Amplification for Sensitive microRNA Detection Directly from Biological Samples. Sensors and actuators. B, Chemical, 279, 447-457.

+ Open protocol

+ Expand

Fluorescence Microscopy Imaging Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Unless otherwise stated, all reagents were purchased from Sigma-Aldrich and sequencing reagents were from Illumina. DFHBI was from Lucerna Technologies (New York, NY). Commercially available reagents were used without further purification. All experiments were carried out with RNase and DNase free H₂O. All Illumina flow cell clustering were performed on a cBot (Illumina) at the Epigenomics Core at Weill Cornell Medical College. DNA sequencing and was performed on a Genome Analyzer IIx (GAIIx; Illumina). Fluorescence images were acquired with a CoolSnap HQ2 CCD camera through a 60× oil objective (Plan Apo 1.4 numerical aperture) mounted on a Nikon TE2000 epifluorescence microscope and analyzed with the NIS-Elements software. FITC was imaged with a sputter-coated excitation filter 470/40 nm, dichroic mirror 495 nm (long-pass), and emission filter 525/50 (Chroma Technology), Cy3 was imaged with a sputter coated excitation filter 560/40 nm and emission filter 630/75 nm (Chroma Technology), Cy5 was imaged with a sputter coated excitation filter 620/60 nm and emission filter 700/75 nm (Chroma Technology), and DAPI was imaged with a sputter coated excitation filter 350/50 nm and emission filter 460/50 nm (Chroma Technology). Image analyses were completed with NIS-Elements AR 3.2 (Nikon). PCR was performed in an Eppendorf Mastercycler ep gradient S thermocycler.

Svensen N., Peersen O.B, & Jaffrey S.R. (2016). Peptide synthesis on a next-generation DNA sequencing platform. Chembiochem : a European journal of chemical biology, 17(17), 1628-1635.

+ Open protocol

+ Expand

Characterization of Bacterial Isolates

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted from selected colonies from all media using Microlysis (Clent Life Science, Amblecote Stourbridge, UK). RAPD PCR typing method was performed with RAPD2 primer (5′-AGCAGCGTGG-3′) as described by Cocconcelli et al. [22 (link)] and REP PCR was carried out with GTG5 primer (5′-GTG GTG GTG GTG GTG-3′) as described by Woods et al. [23 (link)]. PCR was performed in Mastercycler EPgradient S thermocycler (Eppendorf, Hamburg, Germany). PCR products were separated by electrophoresis at 100 V in a 2% agarose gel and stained with Syber Safe (Invitrogen, Carlsbad, California, US). The 16S rRNA gene was amplified using the primers P1 (5′-GCGGCGTGCCTAATACATGC-3′) and P6 (5′-CTACGGCTACCTTGTTACGA-3′). P1 was used to determine the partial 16S rRNA gene sequence. The 16S rRNA gene sequences were compared with the sequences present in the small sub-unit database (SSU-Prok) of Ribosomal Database Project Release 10 [24 (link)]; to obtain taxonomical and similarity rank calculations (S_ab) [25 (link)].

Bassi D., Gazzola S., Sattin E., Dal Bello F., Simionati B, & Cocconcelli P.S. (2020). Lactic Acid Bacteria Adjunct Cultures Exert a Mitigation Effect against Spoilage Microbiota in Fresh Cheese. Microorganisms, 8(8), 1199.

+ Open protocol

+ Expand

Molecular Profiling of Vibrio Virulence

Check if the same lab product or an alternative is used in the 5 most similar protocols

Isolate AB001 was tested for the presence of 10 genes encoding 10 virulence factors by PCR with gene-specific primers (Table 1): SSU enterotoxin (ast), phospholipase A1 (pla), serine protease Ahe2 (ahe2), extracellular nuclease (nucl), phospholipid-cholesterol acyltransferase (gcaT), aerolysins (aerA and aerB), hemolysin (hlyA), elastase (ahpB), and cytotonic enterotoxin (alt). PCR amplification was performed in a 20 μL reaction mixture consisting of 10 μL of the 2 × PCR Master Mix (Thermo Scientific), 1 μL of each primer (10 pmol/μL), 2 μL of template DNA (250–500 ng), and 6 μL of nuclease-free water (Thermo Scientific). PCRs were carried out on a thermal cycler (Mastercycler EP Gradient S thermocycler, Eppendorf, Germany) under the following cycling conditions: initial denaturation at 94 °C for 10 min; 30 cycles of denaturation at 94 °C for 1 min, annealing at optimized temperature of 45.6–55.3 °C appropriate for each primer pair for 1 min, and extension at 72 °C for 1 min; followed by final extension at 72 °C for 5 min. The amplicons were separated electrophoretically in a 1% agarose gel stained with ethidium bromide (10 μg/mL). The electrophoresis was performed in a unit containing Tris-acetate-EDTA buffer (TAE) for 30 min at 100 V, and bands were viewed by means of a UV-transilluminator (Vilber, France).

Bakiyev S., Smekenov I., Zharkova I., Kobegenova S., Sergaliyev N., Absatirov G, & Bissenbaev A. (2023). Characterization of atypical pathogenic Aeromonas salmonicida isolated from a diseased Siberian sturgeon (Acipenser baerii). Heliyon, 9(7), e17775.

+ Open protocol

+ Expand

Quantitative RT-PCR of CHEK1 and MYCN

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with RNeasy Mini Kit (Qiagen) as per manufacturer’s protocol and concentrations were measured on a Nanodrop 1000 spectrophotometer (Thermo Scientific). For two-step Q-PCR, cDNA was synthesized initially using Omniscript RT Kit (Qiagen) and 500ng input RNA was used for each reaction. FastStart Universal SYBR Green Master (ROX) mix was used as per manufacturer’s protocol and samples were run on a Mastercycler epgradient S thermocycler (Eppendorf). Normalized expression ratios were calculated by the relative standard curve method whilst using GAPDH as the endogenous reference mRNA. Primer pairs for CHEK1 were Fw: 5’-ATATGAAGCGTGCCGTAGAC and Rv: 5’-TGCCTATGTCTGGCTCTATTC. Primer pairs for the housekeeping gene GAPDH were Fw: 5’-TGCACCACCAACTGCTTAGC and Rv: 5’-GGCATGGACTGTGGTCATGAG. Primers used for MYCN were Fw: 5’-GACTGTAGCCATCCGAGGAC, Rv: 5’-AATGTGGTGACAGCCTTGGT.

León T.E., Rapoz-D’Silva T., Bertoli C., Rahman S., Magnussen M., Philip B., Farah N., Richardson S.E., Ahrabi S., Guerra-Assunção J.A., Gupta R., Nacheva E.P., Henderson S., Herrero J., Linch D.C., de Bruin R.A, & Mansour M.R. (2020). EZH2 deficient T-cell acute lymphoblastic leukemia is sensitized to CHK1 inhibition through enhanced replication stress. Cancer discovery, 10(7), 998-1017.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!