PCR assays were performed to determine the capsular serotypes for K1 or K2 and another 11 virulence encoding genes, including iucA, entB, uge, magA, terW, iroB, kfuB, rmpA, rmpA2, wabG, and irp2. PCR reaction mixtures were prepared in total volumes of 20 μL. Each reaction contained 1 μL of template DNA, 1 μL (equivalent to 10 pmol concentration) of each primer, and 10 μL of GoTaq® Green Master 2 × Ready Mix (Promega, Madison, WI, USA). The volume was completed to 20 μL by 7 μL of nuclease-free water. The PCR amplification conditions were as follows: initial denaturation for 5 min at 95 °C, then 35 cycles of denaturing at 95 °C for 30 s, annealing for 30 s and extension at 72 °C, followed by a final extension at 72 °C for 7 min. The appropriate annealing temperature for each pair of primers and the time for the extension step for each PCR amplicon are mentioned in Table S1 . DNA fragments of PCR products were detected through TAE agarose gel (1 %) (Bioline, London, UK) electrophoresis in 1 × TAE buffer (Thermo Scientific, Waltham, MA, USA). The Gene Ruler 1 kb DNA molecular weight marker (Thermo Scientific, Waltham, MA, USA) was used for sizing the PCR products.
Gotaq green master 2 ready mix
Manufactured by Promega
Sourced in United States
GoTaq® Green Master 2× Ready Mix is a premixed solution containing Taq DNA polymerase, dNTPs, MgCl2, and reaction buffers. It is designed for use in PCR amplification.
Automatically generated - may contain errors
Lab products found in correlation
3 protocols using gotaq green master 2 ready mix
1
Molecular Typing of Klebsiella Virulence
2
Multiplex PCR for E. coli AMR Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
E. coli isolates were examined by PCR for selected plasmid-carried AMR genes (available at GenBank database) encoding for resistance to diverse classes of antimicrobial drugs and different E. coli pathotypes genes (Table 1 ). PCR reaction mixtures were prepared in total volumes of 20 μL. Each reaction contained 2 μL of template DNA, 1 μL (equivalent to 10 pmol concentration) of each primer and 10 μL of GoTaq® Green Master 2× Ready Mix (Promega, Madison, USA), then the volume was completed to 20 μL by adding 6 μL of nuclease-free water. The PCR amplification programs included initial denaturation for 5 min at 95°C, then 35 cycles of denaturing at 95°C for 30 seconds, annealing for 30 seconds and extension at 72°C, followed by a final extension at 72°C for 7 min. The appropriate annealing temperature for each pair of primers and the time for the extension step for each PCR amplicon are mentioned in Table 1 .
DNA fragments of PCR products were detected using TAE agarose gel (0.8%) (Bioline, London, UK) electrophoresis in 1 × TAE buffer containing ethidium bromide for DNA visualization on a UV light source. A suitable GeneRuler DNA molecular weight marker (Thermo Scientific, USA) was used for sizing the PCR products.
DNA fragments of PCR products were detected using TAE agarose gel (0.8%) (Bioline, London, UK) electrophoresis in 1 × TAE buffer containing ethidium bromide for DNA visualization on a UV light source. A suitable GeneRuler DNA molecular weight marker (Thermo Scientific, USA) was used for sizing the PCR products.
3
Multiplex and Uniplex PCR Detection of Antibiotic Resistance Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The blaKPC, blaNDM, and blaOXA-48 genes29 ,30 were detected using multiplex PCR technique; meanwhile the uniplex PCR was used to detect the blaCTX-M gene. The reaction mixture consisted of 5 μL of the extracted DNA, and 2 μL from the primers forward and reverse; 13 μL of distilled water was added to the GoTaq® Green Master 2× Ready Mix (Promega, USA). The primers and the size of amplicons were collected in Table 1 .
Nucleotide Sequences and Amplicon Size of Oligonucleotides Primers
| Gene | Sequences | Annealing Temperature | Amplicon Size (bp) | References |
|---|---|---|---|---|
| blaCTX-M | F: ATGGTTAAAAAATCACTGCGYC | 51°C | 876 | [26] |
| blaOXA-48 | F: GCGTGGTTAAGGATGAACAC | 45°C | 438 | [27] |
| blaKPC | F: CGTCTAGTTCTGCTGTCTTG | 45°C | 798 | [27] |
| blaNDM | F: GGTTTGGCGATCTGGTTTTC | 45°C | 621 | [27] |
| RmpA | F: ACTGGGCTACCTCTGCTTCA | 53°C | 535 | [28] |
| WabG | F: ACCATCGGCCATTTGATAGA | 58°C, | 683 | [29] |
| uge | F: TCTTCACGCCTTCCTTCACT | 58°C, | 534 | [29] |
| fimH-1 | F: GCCAACGTCTACGTTAACCTG | 43°C | 180 | [20] |
| AcrAB | F: ATCAGCGGCCGGATTGGTAAA | 53°C | 312 | [20] |
| mdtK | F: GCGCTTAACTTCAGCTCA | 43°C | 453 | [20] |
| OmpK 35 | F: CTCCAGCTCTAACCGTAGCG | 51°C | 241 | [20] |
| OmpK36 | F: GAAATTTATAACAAAGACGGC | 43°C | 305 | [20] |
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!