At 48 hr post-fertilization (hpf), Tg(Fli1 :GFP) zebrafish embryos were dechorionated and mounted in 0.8% low melting point agarose pad containing 650 mM of tricaine (ethyl-3-aminobenzoate-methanesulfonate). Embryos were injected in the duct of Cuvier with 27.6 nl of Membright Cy5-labeled EVs (at 1010 EVs/ml) freshly isolated from 4T1-shControl, shRalA, and shRalB cells with a Nanoject microinjector 2 (Drummond) under a M205 FA stereomicroscope (Leica), using microforged glass capillaries (25–30 mm inner diameter) filled with mineral oil (Sigma). Embryos were imaged with confocal right after injection. For experiment testing the role of CD146, 4T1-isolated EVs were incubated with CD146 blocking antibody (12 μg/ml) for 30 min at room temperature before injection.
Nanoject 2 microinjector
Manufactured by Drummond
Sourced in United States, Japan
The Nanoject II microinjector is a precision instrument designed for the intracellular microinjection of fluids. It features adjustable injection volume settings and is suitable for a wide range of applications in cell biology research.
Automatically generated - may contain errors
Lab products found in correlation
Megascript rnai kit, by Thermo Fisher Scientific (3 mentions)
Megascript t7 high yield transcription kit, by Thermo Fisher Scientific (3 mentions)
5xall in one mastermix with accurt genomic dna removal kit, by Applied Biological Materials (3 mentions)
M205 fa stereomicroscope, by Leica (2 mentions)
Mineral oil, by Merck Group (2 mentions)
Hiscribe t7 quick high yield rna synthesis kit, by New England Biolabs (2 mentions)
Taq 2x master mix, by New England Biolabs (2 mentions)
T7 high yield rna transcription kit, by Vazyme (2 mentions)
Tcs sp5 confocal microscope, by Leica (1 mentions)
Wizard sv gel and pcr clean up system, by Promega (1 mentions)
Pgem t easy plasmid, by Promega (1 mentions)
Minelute pcr purification kit, by Qiagen (1 mentions)
Q5 high fidelity dna polymerase, by New England Biolabs (1 mentions)
Megascript t7 transcription kit, by Thermo Fisher Scientific (1 mentions)
Netprimer, by Premier Biosoft (1 mentions)
Prism 6, by GraphPad (1 mentions)
Pclamp 10.4 package, by Molecular Devices (1 mentions)
Microcon ym 100 filter, by Merck Group (1 mentions)
Dextran cascade blue, by Thermo Fisher Scientific (1 mentions)
Nanoject 3 microinjector, by Drummond (1 mentions)
42 protocols using nanoject 2 microinjector
1
Tracking Membright Cy5-labeled EVs in Zebrafish
2
Imaging Tumor Cells in Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
48 h post-fertilization (hpf) Tg(Fli1a:EGFP) embryos were mounted in 0.8% low melting point agarose pad containing 650 µM of tricain (ethyl-3-aminobenzoate-methanesulfonate) to immobilize the embryos. D2A1 LifeAct-TdTomato cells were injected with a Nanoject microinjector 2 (Drummond) and microforged glass capillaries (25 to 30 µm inner diameter) filled with mineral oil (Sigma). 18 nL of a cell suspension at 100.106 cells per ml were injected in the duct of Cuvier of the embryos under the M205 FA stereomicroscope (Leica).
For caudal plexus, confocal imaging was performed with an inverted TCS SP5 confocal microscope with a 20× /0.75 (Leica). The caudal plexus region (around 50 µm width) was imaged with a z-step of less than 1.5 µm for at least 20 embryos per conditions from 3 independent experiments. Cell number and situations was manually characterized (Intravascular, ongoing endothelial remodeling/pocketing, extravascular) using z-projections and orthogonal views in ImageJ.
Correlative Light and Electron Microscopy was performed to describe ultrastructural characteristics of CTCs and the endothelium in the zebrafish embryo. Chosen embryos of both condition (Vehicle and Sunitinib treated) were imaged using confocal microscopy between 3 to 4 hpi. Just after imaging, they were chemically fixed and processed for EM (see dedicated section “EM preparation”).
For caudal plexus, confocal imaging was performed with an inverted TCS SP5 confocal microscope with a 20× /0.75 (Leica). The caudal plexus region (around 50 µm width) was imaged with a z-step of less than 1.5 µm for at least 20 embryos per conditions from 3 independent experiments. Cell number and situations was manually characterized (Intravascular, ongoing endothelial remodeling/pocketing, extravascular) using z-projections and orthogonal views in ImageJ.
Correlative Light and Electron Microscopy was performed to describe ultrastructural characteristics of CTCs and the endothelium in the zebrafish embryo. Chosen embryos of both condition (Vehicle and Sunitinib treated) were imaged using confocal microscopy between 3 to 4 hpi. Just after imaging, they were chemically fixed and processed for EM (see dedicated section “EM preparation”).
3
Asteglut Genes Knockdown in Mosquitoes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Asteglut genes were amplified by the corresponding primers: Asteglut1 (F: 5’-ACA GTA CAA CAG GTG AAG GAA GAG-3’ and R: 5’-GTA ATC CTA CGG TCA CAG CCA AT-3’); Asteglutx (F: 5’-GCT GTC AGG AAT CAA TGC CGT CTT-3’ and R:5’-CGC CAC CTC CGT TAC CTC TTG-3’); Asteglut3 (F: 5’- GCA TTG TTG AGC CAG CCC AAA-3’ and R:5’-CTG CCT CGC CTA GTC CAT TCC-3’); and Asteglut4 (F:5’- CCA GAT TGC CGA ACC GAT GAC-3’ and R:5’-TCA CCG TGC TCA CCG ATG AT-3’). Primers with the T7 promoter sequence (5’-TAA TAC GAC TCA CTA TAG GG-3’) were used to generate templates for double-stranded RNA (dsRNA). The dsRNAs were synthesized using the MEGAscript RNA kit (Ambio, Invitrogen, Shanghai, China). The plasmid eGFP (BD Biosciences, Shanghai, China) was used as a control. Four-day-old mosquitoes were injected with 69 nl dsRNA (4 μg/μl) using a nanoject II microinjector (Drummond, Philadelphia, USA). The dsRNA-treated mosquitoes were collected two days post-treatment and knockdown efficiency was verified by qPCR as previously described [25 (link)].
4
Gene Silencing via dsRNA Microinjection in Sand Flies
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Gene-specific primers (dsAtt-F, dsAtt-R, dsDef2-F, and dsDef2-R) coupled to a T7 promoter sequence (Table S1 ) were designed to amplify templates from sand fly cDNA by PCR. dsLacZ-F and dsLacZ-R primers were used to amplify the template from p-GEM-T Easy plasmid (Promega) as control dsRNA. Touchdown PCR was used as follows: 95 °C for 3 min; 16 cycles of 95 °C for 45 s, 68 to 50 °C (progressively decreasing 1 °C per cycle) for 45 s, and 72 °C for 45 s; 26 cycles of 95 °C for 45 s, 50 °C for 45 s, and 72 °C for 45 s; 72 °C for 3 min. These templates were purified by Wizard SV Gel and PCR cleanup system (Promega) and used in dsRNA synthesis reaction by MEGAscript RNAi kit (Invitrogen) following the manufacturer’s instructions. The produced dsRNA was lyophilized and resuspended in ultrapure H2O to 4.5 μg/μL final concentration. Sand flies were microinjected intrathoracically with 32.2 nL of dsRNA using Nanoject II microinjector (Drummond) [39 (link)].
5
dsRNA synthesis for mosquito RNAi
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To create dsRNAs for RNA interference, DNA templates 300–600 bp in length were synthesized using Q5 High-Fidelity DNA Polymerase (New England BioLabs, Ipswich, MA) from A. aegypti cDNA using primer pairs designed to target the coding sequences of each candidate gene111 (link). Primers were designed using the Primer-BLAST online tool109 and were linked with a T7 promoter sequence at the 5′ end (TAATACGACTCACTATAGGGAGACCAC)112 (link). PCR product size and purity were verified through gel electrophoresis and isolated with MinElute PCR Purification Kit (Qiagen). Templates were then used to produce dsRNA using the MEGAscript T7 Transcription Kit (Ambion, Foster City, CA) and precipitated with lithium chloride as per manufacturer’s instructions. Purified dsRNA products were diluted to a concentration of 4.35 ng/nL and prepared for microinjection together with either DENV3 virus or sterile medium by mixing in a 1:1 (dsRNA:media) ratio. In total, 138 nL of this mixture was injected into WT and wMel mosquitoes with the Nanoject II microinjector (Drummond Scientific). As a control for dsRNA knockdown, mosquitoes were also injected with dsRNA targeting GFP. Knockdown efficiency was measured using five mosquitoes per condition.
6
Knockdown of PanK in Anopheles stephensi
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PanK RNAi forward and reverse primers were designed using NetPrimer (PREMIER Biosoft, San Francisco, CA) to knock down A. stephensi PanK transcript: PanK RNAi-F 5′ TAATACGACTCACTATAGGGAGA ACGCTGACGAAGCTGGTGTA 3′ and PanK RNAi-R 5′ TAATACGACTCACTATAGGGAGA CGGTGAGCAGACAGCACAG 3′ (T7 RNA polymerase promoter sequence is underlined). The expected amplicon (607 bp) was PCR amplified using Taq 2X Master Mix (New England Biolabs, Ipswich, MA, USA) with A. stephensi midgut cDNA as the template. Double stranded RNA (dsRNA) was synthesized using HiScribe T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, Ipswich, MA, USA). Cold-anesthetized female mosquitoes were intrathoracically microinjected twice with 276 nL dsRNA (8 μg/μL) using a Nanoject II microinjector (Drummond Scientific, Broomall, PA). The first injection was performed within 4 h of adult eclosion and the second injection was completed at 3 d post-eclosion. Injected mosquitoes were maintained on 10% sucrose throughout the experiments. Firefly luciferase dsRNA (dsRNA-FLuc) was synthesized and injected following the above protocol as a negative control [14 (link),15 (link)]. Injected mosquitoes were provided a blood meal at 5 d after adult eclosion; dissected midguts were collected for analysis immediately prior to blood feeding (NBF) and at 2, 6, and 24 h post-blood feeding.
7
Gene Silencing in Mosquitoes via dsRNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cDNA clones of target genes were obtained using gene-specific primers (Table S4 ). PCR amplicons of GFP, V-ATpase_H_N3 and caudal tailed with a T7 promoter (TAA TAC GAC TCA CTA TAG GGA GA) were used to synthesize dsRNAs using a MEGAscript T7 High Yield Transcription kit (Thermo Fisher, China). Four- to six-day-old females received a total 69 nL dsRNAs (4 μg/μL) through intra-thoracic microinjection using a Nanoject II microinjector (Drummond, USA). Injected mosquitoes were allowed to recover for four days prior to infection (Blandin et al., 2002 (link)). Silencing efficiency was verified by qPCR four days post dsRNA treatment using the primers listed in Table S4 . The cDNA was prepared from total RNA using the 5XAll-in-One MasterMix (with AccuRT Genomic DNA Removal Kit) (ABM, China). Levels of target genes were determined by a Roche LightCycler 96 Real Time PCR Detection System with SYBR Green qPCR Master Mix (Biomake, China). The data were processed and analyzed with LightCycler 96 software. Ribosomal gene S7 of An. stephensi and 18S rRNA of P. berghei were used as the internal references (Baptista et al., 2010 (link); Dimopoulos et al., 1996 (link)). Relative quantitation results were normalized with reference genes and analyzed by the 2−ΔΔCt method (Livak and Schmittgen, 2001 (link)). Gene expression of the dsRNA treated group was normalized to that of dsGFP controls.
8
Measuring Ae. aegypti Excretory Capacity
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The excretory capacity of adult female Ae. aegypti (LVP strain) was measured as described previously15 (link)16 (link). In brief, groups of 5 mosquitoes were treated with a sub-lethal dose of VU041 (1.7 μg/mg mosquito), VU937 (1.7 μg/mg mosquito), or solvent 2 h before injecting the hemolymph of each mosquito with 900 nL of a potassium-enriched, phosphate-buffered saline (K+-PBS) using a Nanoject II microinjector (Drummond Scientific Company, Broomall, PA). The K+-PBS consisted of the following (in mM): 92.2 NaCl, 47.5 KCl, 10 Na2HPO4 and 2 KH2PO4 (pH 7.5). Each treatment group of 5 mosquitoes was transferred into a separate graduated, packed-cell volume tube (MidSci, St. Louis, MO) and held for 1 h at 28 °C. The volume excreted by the mosquitoes was measured visually via the graduated column at the bottom of the tube. At least 8 replicates (5 mosquitoes per replicate) were performed for each treatment. All mosquitoes were confirmed to be alive at the end of 1 h. The mean volumes excreted by solvent-, VU041-, and VU937-treated mosquitoes were analyzed using a one-way ANOVA with a Newman-Keuls post hoc analysis (Prism 6, Graphpad Software).
9
Knockdown of Target Genes in Insects
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Purified dsRNA was resuspended with high-performance liquid chromatography-grade water (Thermo Fisher Scientific) at 5 μg/μL. Newly emerged virgin females were separated using a manual aspirator into a new cage and provided with 10% sucrose. Three days after eclosion, virgin females were anesthetized on ice and injected with 2.0 μg dsRNA (400 nL) using a Nanoject II microinjector (Drummond Scientific Company). After injection, females were placed back in a cage with 10% sucrose to recover for 24 h at 27 °C with 80% humidity.
10
RNAi Silencing of Ae. aegypti Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
Ae. aegypti Liverpool strain (provided by D. Severson, University of Notre Dame, IN, USA) were maintained on 10% sugar solution at 28°C with a photophase of 16 h and 80% relative humidity according to the standard rearing procedures.
RNAi-based gene-silencing assays were conducted by injecting 500 ng of dsRNA (dsAgo-2 or dsFFLuc) in water into the thorax of cold-anesthetized 4 day-old females using a Nanoject II microinjector (Drummond Scientific Company). Blood feeding was carried out 48 h post dsRNA injection. Gene silencing validations were performed at day 1, 2, 3, 4 and 7 after ingestion of the infectious blood-meal. As controls, mosquitoes injected with PBS and non-injected unfed mosquitoes were used.
+ Expand
Ae. aegypti Liverpool strain (provided by D. Severson, University of Notre Dame, IN, USA) were maintained on 10% sugar solution at 28°C with a photophase of 16 h and 80% relative humidity according to the standard rearing procedures.
RNAi-based gene-silencing assays were conducted by injecting 500 ng of dsRNA (dsAgo-2 or dsFFLuc) in water into the thorax of cold-anesthetized 4 day-old females using a Nanoject II microinjector (Drummond Scientific Company). Blood feeding was carried out 48 h post dsRNA injection. Gene silencing validations were performed at day 1, 2, 3, 4 and 7 after ingestion of the infectious blood-meal. As controls, mosquitoes injected with PBS and non-injected unfed mosquitoes were used.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!