Apex2 nes

The pCAG-vGlut1-mCherry and pCAG-Cre vectors were previously described^{37 (link)}. The pcDNA3 APEX2-NES (Addgene plasmid #49386) and pAAV-Ef1a-DIO eNpHR 3.0-EYFP (Addgene plasmid #26966) vectors were gifts from Drs. Alice Ting (Stanford University) and Karl Deisseroth (Stanford University), respectively. The flag-APEX2-NES sequence was cloned into the 5′ end of the Venus sequence and the CAAX Motif-AAGCTGAACCCTCCTGATGAGAGTGGCCCCGGCTGCATGAGCTGCAAGTGTGTGCTCTCCTGA (KLNPPDESGPGCMSCKCVLS) was fused to the 3′ end of the Venus cDNA (APEX2-Venus-CAAX, AVC). Then, APEX2-Venus-CAAX (AVC) sequence was exchanged with the eNpHR-EYFP segment of the pAAV-Ef1a-DIO eNpHR 3.0-EYFP vector by AscI-NheI sites (pAAV-Ef1a-DIO-AVC).

HEK293 cells were seeded at a density of 5.0 × 10⁵ cells/well in a 6-well plate and cultured in a medium for 24 h. The APEX2 construct and the plasmids expressing sgRNA were mixed with Mirus (Mirus Bio LLC, USA) according to the manufacturer’s instructions and introduced into cells for 42 h when they had grown to a confluence of 60 to 90%. Approximately 42 h after transfection of two plasmids, ssAAV2 and scAAV2 were infected for 6 h in HEK293 cells. A well was prepared to transfect with a negative-control construct (lacking APEX2) using the same transfection procedure. Another well was prepared to transfect with the APEX2 construct known to produce strong DAB staining, such as APEX2-NES (Addgene, cat. no. 49386) or APEX2-actin (Addgene, cat. # 66172) as a positive control.