Doc cam u3 50s5m c

Flower buds were fixed in Farmer’s fixative at 25°C for 12 h. The preparation of nuclei and hybridization of DNA with FISH probes were performed as described previously [43]. The DNA probes were synthesized as follows. Probes recognizing the centromeric 180 bp repeats (FP; 5ʹ-GATCAAGTCATATTCGACTC-3ʹ, RP; 5ʹ-GTTGTCATGTGTATGATTGA-3ʹ) was synthesized by nick translation using Biotin Nick Translation Mix (Roche, Basel, Switzerland). Probes recognizing 5S rDNA (FP; 5ʹ-GCGGAGCTCCCCAAATTTTGAC-3ʹ, RP; 5ʹ-GACCACGTGGTCGACAAAAAGTC-3ʹ), 45S rDNA (FP; 5ʹ-CAAGCAAGCCCATTCTCCTC-3ʹ, RP; 5ʹ-CAACTAGACCATGAAAATCC-3ʹ), and telomere repeats (FP; 5ʹ- TAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCCTAAACCC −3ʹ, RP; 5ʹ- GGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTA-3ʹ) were synthesized by nick translation using DIG Nick Translation Mix (Roche). The hybridized nuclei were mounted with VECTASHIELD™ (Vector Laboratories, Burlingame, CA). The nuclei were observed under a light microscope (BX53m, Olympus, Tokyo, Japan) equipped with a CCD camera (DOC CAM U3-50S5M-C, Molecular Devices, Tokyo, Japan). The overlapping of the 180 bp signals and the 45S rDNA signals was analyzed with the ImageJ software. The distances between the position showing the maximum intensity of 5S rDNA signals and that of the nearest 180 bp signals were analyzed with the ImageJ software.

Young flower buds were used for the cytogenetic analysis. Fluorescence in situ hybridization (FISH) was performed essentially as previously described [22 (link)], with some modifications. Centromeric 180 bp repeats and 45S rDNA were amplified from the genomic DNA with sets of primers (180 bp-F: 5′-GATCAAGTCATATTCGACTC-3′, 180 bp-R: GTTGTCATGTGTATGATTGA and 45S rDNA-F: 5′-CAAGCAAGCCCATTCTCCTC-3′, 45S rDNA-R: 5′-CAACTAGACCATGAAAATCC-3′). Amplified 180 bp repeats and 45S rDNA were labeled by nick translation with biotin-16-dUTP (Roche, Basel, Switzerland) and digoxigenin-11-dUTP (Roche), respectively. Streptavidin-Alexa 488 (Invitrogen, Carlsbad, CA) was used for the detection of biotin-labeled probe, and anti-digoxigenin-Rhodamine Fab fragments (Roche) were used for detection of dig-labeled probe. Slides were counter-stained using 0.2 μg/ml DAPI and observed using fluorescent microscopy (BX53, Olympus, Tokyo, Japan) with a ×100 objective (UPLSAPO ×100, Olympus). Images were captured using a CCD camera (DOC CAM U3-50S5M-C, Molecular Devices, Sunnyvale, CA) controlled with MetaVue (Molecular Devices). The distances between 45S rDNA and 180 bp signals were measured using Fiji software [23 (link)].