Ferritin heavy chain (Fth1) was deleted in N2a cells using commercially available double nickase (CRISPR/Cas9) plasmids. Neuro2a cells were transfected with the Fth1 CRISPR/Cas9 KO plasmid plus the HDR plasmid (Santa Cruz Biotechnology Inc.). The Fth1 KO plasmid uses 20-nucleotides guide RNA sequences targeting the mouse Fth1 gene. The HDR plasmid incorporated the puromycin resistance gene and the red fluorescent protein (RFP) for selection of cells where the Fth1 gene have knocked out. Cells were transfected with both Fth1 KO and HDR plasmids. 24 h later, cells were selected in DMEM supplemented medium containing puromycin (5mg/mL) for 7–14 days. Surviving cells were harvested, washed, and sorted with flow cytometry to select the RFP positive (RFP+). Following, RFP+ cells were serially diluted into a 96-well plate. Wells containing single cells were expanded and screened by RT-PCR for full-length Fth1 mRNA. Deletion was confirmed by RT-PCR and western blot for two cell colonies (#1 and #4). Following, the RFP+ cell colony #4, corroborated as knocked out for Fth1, was selected for propagation (Figure 4A ). For imaging experiments, the RFP gene, flanked by two LoxP sites, was removed by transfecting the Na2Fth1KO cells with the Cre plasmid. Next, cells were sorted by flow cytometry and those cells negative to RFP expression were propagated.
Hdr plasmid
Manufactured by Santa Cruz Biotechnology
The HDR plasmid is a laboratory tool designed for gene editing applications. It serves as a template for homology-directed repair (HDR), a cellular process that can be utilized to precisely modify targeted genomic sequences.
Automatically generated - may contain errors
Lab products found in correlation
4 protocols using hdr plasmid
1
Generating Fth1 Knockout N2a Cells
2
Targeting CD44 in Breast Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Oligonucleotides encoding short hairpin RNAs (shRNA) that target standard exons of CD44 were cloned into the plasmid vector Plkd-cmv-GFP-hU6 Puro (OBio, China). The plasmids were transfected into BCCs, and the cells were cultured for 2 weeks in the presence of puromycin (4 μg/mL; Sigma-Aldrich). BCCs transfected with Plkd-cmv-GFP-hU6-control shRNA were used as controls. The shRNA results were evaluated by western blots.
The CD44 CRISPR/Cas9 KO plasmid, HDR plasmid and control CRISPR/Cas9 plasmid were purchased from Santa Cruz Biotechnology. BCCs (5 × 104) were plated on 24-well plates. After 24 h of incubation, the cells were transfected with CRISPR/Cas9 plasmids according to the manufacturer’s protocol when they reached 60% confluence. The ratio of the target plasmid to the transfection reagent was 0.5 μg/2.5 μL. After 25 min of incubation at room temperature, the complexes were added to the cells. After the cells were expanded, cells with positive expression were sorted, and the effects of CD44 knockout were evaluated by western blots.
The CD44 CRISPR/Cas9 KO plasmid, HDR plasmid and control CRISPR/Cas9 plasmid were purchased from Santa Cruz Biotechnology. BCCs (5 × 104) were plated on 24-well plates. After 24 h of incubation, the cells were transfected with CRISPR/Cas9 plasmids according to the manufacturer’s protocol when they reached 60% confluence. The ratio of the target plasmid to the transfection reagent was 0.5 μg/2.5 μL. After 25 min of incubation at room temperature, the complexes were added to the cells. After the cells were expanded, cells with positive expression were sorted, and the effects of CD44 knockout were evaluated by western blots.
3
Generating INF2 Knockout Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To knock out INF2 in human cell lines we obtained a mix of three different CRSPR/Cas9 plasmids and the corresponding HDR plasmids from Santa Cruz (sc-410096). gRNA sequences: A: Sense: GAGGAGCTGCTGCGAGTCTC; B: Sense: GGTCGACATGAGCAGCCACC; C: Sense: CAGCGACAACGTGCCCTACG. HeLa wt cells were co-transfected with both plasmid mixes using Fugene6 and grown for 24 hr without selection. We visually confirmed the appearance of RFP expressing cells indicated successful disruption of INF2. We next grew cells for two weeks under selection pressure with 0.5 µg/ml puromycin. The population of stable puromycin resistant cells was then transfected twice with a Cre expression vector (Santa Cruz) using Fugene6 to remove the RFP and puromycin cassette. Finally, we selected individual INF2 KO clones by limited dilution in 96-well plates. All clones were characterized for INF2 expression by Western blot and immunofluorescence and for absence of CaAR induction (Rhodamine-phalloidin staining) upon ionomycin stimulation.
4
MAOB CRISPR/Cas9 KO in Hep3B Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
HuH-7 or Hep3B cells (3 × 104 cells/dish, in a 30 mm-diameter dish) were transfected with 1 μg of MAOB CRISPR/Cas9 KO plasmids and 1 μg of HDR plasmids (Santa Cruz Biotechnology). After an approximately 2 week screening with 2 μg/ml puromycin, Hep3B, but no HuH-7 cell clones, were established by confirming RFP fluorescence on a laser-scanning confocal fluorescence microscope (LSM-700; Carl Zeiss, Berlin, Germany; see supplemental Fig. S1) and a lack of both MAOB mRNA expression using the QRTPCR method and MAOB protein expression using the Western blotting method were confirmed in these Hep3B/MAOB-KO cells.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!