Log In Sign up
The largest database of trusted experimental protocols

Pcdh ef1 mcs bgh pgk gfp t2a puro vector

Manufactured by System Biosciences
Visit Supplier

The PCDH-EF1-MCS-BGH-PGK-GFP-T2A-Puro vector is a versatile expression plasmid that can be used for various cell biology applications. It contains a multiple cloning site (MCS) for inserting genes of interest, the EF1 promoter for driving expression, and a GFP-T2A-Puromycin selection cassette for monitoring and selecting transfected cells.

Automatically generated - may contain errors

Lab products found in correlation

Ppackh1 packaging plasmid, by System Biosciences (1 mentions)

Close spelling variants of this product

PCDH-EF1-MCS-(PGK-GFP-T2A-Puro) PCDH-EF1-MCS-T2A-Puro vector PCDH-EF1-MCS-T2A-Puro PCDH-EF1-T2A-Puro vector PCDH-MCS-T2A-Puro vector PCDH-GFP PCDH vector

2 protocols using pcdh ef1 mcs bgh pgk gfp t2a puro vector

1

miR-129-2 precursor cloning

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cloning of precursor sequence of miR 129-2 (5′UGCCUUUCGCGAAUCUUUUU CUGUACAUAACUCAAUAGCCGGAAGCCCUUACC CCAAAAAGCAUUCGCGGAGGGCG 3′) into HIV based lentiviral vector, pCDH-EF1-MCS-BGH-PGK-GFP-T2A-Puro vector (System Biosciences), was performed by GenScript. Briefly, miR129-2 precursor sequence from pmiR129-2 plasmid was isolated and cloned into pCDH-EF1-MCS-BGH-PGK-GFP-T2A-Puro vector using EcoR1 and Not1 restriction sites. After sequence verification, E.coli were transformed with the right clone and vector was expanded by DNA mini-preparation.
Yadavilli S., Scafidi J., Becher O.J., Saratsis A.M., Hiner R.L., Kambhampati M., Mariarita S., MacDonald T.J., Codispoti K.E., Magge S.N., Jaiswal J.K., Packer R.J, & Nazarian J. (2015). The emerging role of NG2 in pediatric diffuse intrinsic pontine glioma. Oncotarget, 6(14), 12141-12155.
+ Open protocol
+ Expand
2

Generating Lentiviral CDA Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Full-length cDNA of human CDA cDNA [22 (link)] was subcloned into pCDH-EF1-MCS-BGH-PGK-GFP-T2A-Puro Vector (System Bioscience) to generate a pCDH-CDA construct. Lentiviral particles were produced by co-transfection with pCDH-CDA and pPACKH1 packaging plasmid (System Bioscience) into 293TN cells using Lipofectamine LTX, in accordance with the manufacturer’s instructions. MDS-L overexpressing CDA (MDS-L/CDA) cells were then established by lentiviral infection.
Murakami Y., Kimura Y., Kawahara A., Mitsuyasu S., Miyake H., Tohyama K., Endo Y., Yoshida N., Imamura Y., Watari K., Ono M., Okamura T, & Kuwano M. (2019). The augmented expression of the cytidine deaminase gene by 5-azacytidine predicts therapeutic efficacy in myelodysplastic syndromes. Oncotarget, 10(23), 2270-2281.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!