Typhoon image analyzer

The deoxyinosine (dI)-containing oligonucleotide (45-I25, 5′-dCGAACTGCCTGGAATCCTGACGACITGTAGCGAACGATCACCTCA), labeled by Cy5 at the 5′ terminus and its complementary oligonucleotide (45R, 5′-dTGAGGTGATCGTTCGCTACATGTCGTCAGGATTCC- AGGCAGTTCG) were obtained from Sigma Aldrich (Tokyo, Japan) Double-stranded DNA was prepared by annealing 45-I25 and 45R in TAM buffer (40 mM Tris-acetate, pH 7.8 and 0.5 mM Mg(CH₃COO)₂). The cleavage reactions were performed at 75 °C for 10 min in a 20 μl reaction mixture, containing 50 mM Tris-HCl, pH8.0, 1 mM DTT, 1 mM MgCl₂, 0.01% Tween20, 0.4 M NaCl, 5 nM DNA substrate, 10 nM TkoEndoQ and various concentrations of TkoPCNA1 (0, 0.18, 0.6, and 1.8 μM, as a monomer). Reactions were terminated with 40 μl of stop solution (98% deionized formamide, 10 mM EDTA and 0.1% OrangeG). After an incubation at 95 °C for 5 min, the samples were immediately placed on ice. The samples were separated by 8 M urea-12% PAGE in TBE buffer (89 mM Tris-borate and 2.5 mM EDTA). The gel image was visualized and the resulting bands were quantified with a Typhoon image analyzer (GE healthcare).

Purification of the recombinant RIG-I, MDA5, and LGP2 proteins was performed as described previously [8 (link),14 (link)]. EMSAs were performed in binding buffer (20 mM Tris [pH 8.0], 1.5 mM MgCl₂, 50 mM NaCl, 1.5 mM DTT, 100 ng/μL sonicated salmon sperm DNA, 5% glycerol, and 0.4 U/mL RNasin [Promega, Madison, WI, USA]). Each purified protein (3 μM) was incubated with 0.5 nM siRNA containing ³²P-labeled guide strand for 30 min on ice. The samples were electrophoresed on a 9% polyacrylamide gel in 0.25 × TBE buffer. For quantification, gels were exposed to a Fuji imaging plate and scanned with a Typhoon image analyzer (GE Healthcare, Chicago, IL, USA).