Alkbh5 sirna

Mouse Prrc2a, Fto, and Alkbh5 siRNAs were designed and synthesized by Genepharma Corporation (Suzhou, China). The following siRNA were synthesized and used in the study: Prrc2a siRNA 1#: 5′-CAUGAAGAGGUUGACUAUA-3′, Prrc2a siRNA 2#: 5′-GCUUGUAUAUAGAUUAUAA-3′, FTO siRNA: 5′-GCAGCUGAAAUACCCUAAA-3′, Alkbh5 siRNA: 5′-ACAAGUACUUCUUCGGCGA-3′, Scrambled siRNA (siNC): 5′-UUCUCCGAACGUGUCACGU-3′. Transfections were performed with Lipofectamine RNAiMAX (Invitrogen) for siRNA, and Lipofectamine 2000 (Invitrogen) for plasmid following the manufacturer’s instructions.

The Snail siRNA was purchased from Santa Cruz Biotechnology (Santa Cruz, CA), and ALKBH5 siRNA (CCATGACGTCCCGGGACAACTATAA) was constructed and obtained from Invitrogen. siRNAs (40 nM diluted in 1 mL Opti-MEM) were transfected to SK-OV3 cells using Lipofectamine RNAiMAX (#13778150, Invitrogen). The plasmid of wild-type (pENTER-ALKBH5) and mutated ALKBH5-H204A (pENTER-ALKBH5-H204A) was obtained from WZ Biosciences Inc, while plasmid of wild-type (pSLenti-Snail) and mutated Snail (pSLenti-Snail-mut, adenosine bases in m6A consensus sites replaced by cytosine nucleotides) was constructed and obtained from OBiO Technology. Plasmid (2 µg diluted in 1 mL Opti-MEM) was transfected to SK-OV3 cells using Lipofectamine 3000 Transfection Reagent (#L3000015, Invitrogen). The shRNA of human ALKBH5 was cloned into a lentiviral vector (pLent-3in1-shRNA-CMV-copGFP-P2A-Puro) for knockdown. Sequences of the shRNAs were as followed, stably transfected SK-OV3 cells were selected using puromycin (#ST551, Beyotime, China): siRNA1: GTCCTTCTTTAGCGACTCT; siRNA2: CCATGACGTCCCGGGACAACTATAA; siRNA3: GCTCAGTGGATATGCTGCTGATGAA.