The largest database of trusted experimental protocols

Abi qpcr model 7300

Manufactured by Thermo Fisher Scientific
Sourced in United States

The ABI qPCR model 7300 is a real-time quantitative PCR (qPCR) system designed for gene expression analysis and quantification. The system utilizes fluorescence detection to monitor the amplification of target DNA sequences in real-time during the PCR process. It features a 96-well thermal cycler and supports a wide range of fluorescent dyes and probe technologies.

Automatically generated - may contain errors

2 protocols using abi qpcr model 7300

1

Quantitative RT-PCR Analysis of Cartilage Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols
mRNA was isolated using RNeasy mRNA purification columns (Qiagen, Venlo, Netherlands). cDNA was prepared using the OneStep RT–PCR kit (Invitrogen, Waltham, Massachusetts, USA). qPCRs were performed using an ABI qPCR model 7300 or 7900 (Applied Biosystems, Waltham, Massachusetts, USA) with purified samples containing a SYBER Green mix (Applied Biosystems). Primers were as follows: SIRT1‐forward: CAGATTAGTAGGCGGCTTGA; reverse: CTAA ACTTGGACTCTGGCAT; COL2A1 (Exon 2)‐forward: GAGCCCTGCCGGATC TGT; reverse: GAGGCAGTC TTTCACGTCTTC; Matrix Metallopeptidase 13 (MMP13)‐forward: AGTTTGCAGAGCGCTACCTGAGAT; reverse: TTTGCCAGT CACCTCTAAGCCGAA; ADAMTS5‐forward: TTCAACGTCAAGCCATGGCAA CTG; reverse: TGACGATAGGCAAACTGCACTCCT; SOX9‐forward:AGGCAA GCAAAGGAGATGAA; reverse: TGGTGTTCTGAGAGGCACAG; ACAN‐forward: TGCGGGTCAACAGTGCCTATC; reverse: CACGATGCCTTTCACCAC GAC. Values were normalized to those obtained for human beta 2‐microglobulin (B2MR) or glyceraldehyde 3‐phosphate dehydrogenase (GAPDH), which were unaffected by the experimental treatments: B2MR‐forward: ACCCCCACTGAAAAAGATG AG; reverse: ATCTTCAAACCTCCATGATGC; GAPDH‐forward: TACTAGCGGT TTTACGGGCG; reverse: TCGAACAGGAGCAGAGAGCGA. Mouse Gapdh: forward: TGCCCCCATGTTTGTGATG; reverse: TGTGGTCATGAGCCCTTCC. Mouse Acan‐forward: GCTGGCTGACCAGACAGTCA; reverse: CCGGATTC CGTAGGTTCTCA.
+ Open protocol
+ Expand
2

Quantifying Gene Expression via RT-qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
mRNA was isolated using RNeasy mRNA purification columns (Qiagen, Hilden, Germany). cDNA was then prepared using the OneStep RT-PCR kit according to the manufacturers guidelines (Invitrogen Carlsbad, CA, USA). Real-time PCR reactions were performed using an ABI qPCR model 7300 or 7900 (Applied Biosystems, Foster City, CA, USA) with purified samples containing a Syber Green mix (Applied Biosystems) in accordance to the manufacturers’ guidelines. Primers for quantitative PCR were prepared for the following human genes: Cathepsin S(CAT), forward: 5′-GACTGGAGAGAGAAAGGGTGTGTT-3′, reverse: 5′-CAGCTTTCCTGTTTTCAGCTTCA-3′, hβ2MG-F: ACCCCCACTGAAAAAGATGAG; reverse: ATCTTCAAACCTCCATGATGC; GAPDH-F: TACTAGCGGTTTTACGGGCG; R: TCGAACAGGAGCAGAGAGCGA.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!