N-terminally and C-terminally Flag/HA tagged MmuPV1 E7 and HPV16 E7 were cloned into pCMV Bam/neo vectors [82 (link)]. The MmuPV1 E7K81S mutant was PCR amplified with primers containing the K81S mutation and Q5 High Fidelity Polymerase (NEB). The PCR product was treated with DpnI (NEB) for 1 hour, then transformed into 10-Beta competent E. coli cells (NEB).
10 beta competent e coli cells
Manufactured by New England Biolabs
10-beta competent E. coli cells are a strain of Escherichia coli bacteria that have been treated to become highly efficient at taking up and incorporating foreign DNA, such as plasmids, during a process called transformation. These cells are commonly used in molecular biology and genetic engineering applications.
Automatically generated - may contain errors
Lab products found in correlation
Q5 high fidelity polymerase, by New England Biolabs (1 mentions)
Dpni, by New England Biolabs (1 mentions)
Purelink expi endotoxin free maxi plasmid purification kit, by Thermo Fisher Scientific (1 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (1 mentions)
Hifi dna assembly mix, by New England Biolabs (1 mentions)
Qiaprep spin miniprep kit, by Qiagen (1 mentions)
Q5 high fidelity dna polymerase, by New England Biolabs (1 mentions)
Pet duet 1, by New England Biolabs (1 mentions)
Taq polymerase, by Takara Bio (1 mentions)
Pacycduet 1, by Merck Group (1 mentions)
T7 express competent e coli cells, by New England Biolabs (1 mentions)
Pacycduet 1, by New England Biolabs (1 mentions)
Dneasy blood and tissue kit, by Qiagen (1 mentions)
Petduet 1, by Merck Group (1 mentions)
4 protocols using 10 beta competent e coli cells
1
Cloning and Mutagenesis of MmuPV1 and HPV16 E7 Proteins
2
Transfection of Manf siRNA Lentivectors
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Scrambled siRNA-GFP and Manf siRNA-GFP lentivector plasmids were purchased from Applied Biological Materials (Richmond, BC, Canada) with the MANF siRNA target sequence 5′-TCAAAGACAGAGATGTCACATTTTCACCA-3′ cloned into the piLenti-siRNA-GFP plasmid backbone. The siRNA is driven by the U6 promotor followed by the GFP driven by the CMV promotor. The plasmids were subcloned and amplified in 10-beta competent E. coli cells (New England Biolabs), and purified using PureLink Expi Endotoxin-free Maxi Plasmid Purification Kit (Thermo Fisher Scientific). Either 2.5 μg of scrambled siRNA or Manf siRNA lentivector plasmids were transfected into N2a or SH-SY5Y cells using Lipofectamine 3000 Reagent (Life Technologies) according to the manufacturer’s instruction. Cells were subject to subsequent analysis.
3
Cloning of Cytosolic Diterpenoid Biosynthetic Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cloning of cytosolic diterpenoid boost, tHMGR and GGPPS, and cytosolic TS are described in previous study28 (link). Taxus TS1, TS2, T5αH, TAT, T10βΗ, DBAT, T13αΗ, and TAX19 genes (Supplementary Table 9 ) were synthesized by Gen9 Bio (San Jose, CA) and amplified by PCR using Q5 High-Fidelity DNA Polymerase (New England BioLabs) and gene-specific primers from Integrated DNA Technologies (Supplementary Table 10 ). PCR amplicons were ligated with AgeI- and XhoI- (New England BioLabs) linearized pEAQ-HT vector27 (link) using HiFi DNA assembly mix (New England BioLabs). Constructs were transformed into 10-beta competent E. coli cells (New England BioLabs). Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (Qiagen) and sequence verified by Elim Biopharm.
4
Cloning and Co-expression of HpaII Methyltransferases
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Haemophilus influenzae was acquired from the American Type Culture Collection (ATCC® 49699™), and cultured in ATCC® Medium 814: GC Agar/Broth Medium (Teknova) at 37°C overnight with shaking. Total genomic DNA was isolated with the DNeasy Blood and Tissue Kit (Qiagen). The HpaII gene was amplified using forward primer GAGATATACCATGGCTGAATTTTTTTCTGGTAATAGAGG and reverse primer TCGAGGCTGCAGTTATAAGAATCTAATTTGTACGTTTAACTTAATAAAAAAATC (IDT, San Diego, CA) and the M. HpaII gene was amplified using forward primer AGATATACATATGAAAGATGTG TTAGATGATAA CTTGTTAG and reverse primer TCGAGGGTACCTCAGTCATATAAATTTCCTAATTTTTCT AAAATTTTCTTACCT (IDT, San Diego, CA). PCR was performed with Taq polymerase (Clontech) using the following cycle 95°C for 5 minutes, 40 cycles of (94°C for 15 seconds, 55°C for 15 seconds, 72°C for 1 minute), and 72°C for 5 minutes. The ~1100 bp HpaII PCR fragment was cloned using NcoI and PstI restriction sites in frame with the 5’ His tag of pETDuet-1 (EMD Millipore). The ~1100 bp M. HpaII PCR fragment was cloned using NdeI and KpnI into pACYCDuet-1 (EMD Millipore).
Recombinant vectors were isolated in 10-beta Competent E. coli cells (New England Biolabs). Co-transformations with pETDuet-1/HpaII and pACYCDuet-1/M. HpaII were executed in T7 Express Competent E. coli cells (New England Biolabs) by heat shock.
Recombinant vectors were isolated in 10-beta Competent E. coli cells (New England Biolabs). Co-transformations with pETDuet-1/HpaII and pACYCDuet-1/M. HpaII were executed in T7 Express Competent E. coli cells (New England Biolabs) by heat shock.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!