Power sybr green rt pcr kit

Total RNA was extracted from muscles using TRIzol (Invitrogen). Complementary DNA was generated from 0.4 μg of RNA reverse‐transcribed with SuperScript III Reverse Transcriptase (Invitrogen). cDNA samples were then amplified on the 7900HT Fast Real‐Time PCR System (Applied Biosystems) using the Power SYBR Green RT‐PCR kit (Applied Biosystems). All data were normalized to HPRT and to GAPDH expression.

Total RNA was extracted from muscles using TRIzol (Invitrogen). Complementary DNA was generated from 0.4 μg of RNA reverse transcribed with SuperScript III Reverse Transcriptase (Invitrogen). cDNA samples were then amplified on the 7900HT Fast Real‐Time PCR System (Applied Biosystems) using the Power SYBR Green RT‐PCR Kit (Applied Biosystems). All data were normalized to HPRT and to GAPDH expression.

Total RNA was prepared from gastrocnemius muscles or liver using TRIzol (Invitrogen). Complementary DNA was generated from 0.4 μg of RNA reverse-transcribed with SuperScript III Reverse Transcriptase (Invitrogen). Duplicates of cDNA samples were then amplified on the 7900HT Fast Real-Time PCR System (Applied Biosystems, MA, U.S.) using the Power SYBR Green RT-PCR kit (Applied Biosystems). The relative expression ratio of target gene was calculated based on PCR efficiency and quantification cycle deviation (∆Cq) of an unknown sample versus a control, and expressed in comparison to the reference gene [20 (link)]. All data were normalized to the reference gene GAPDH expression, of which abundance did not change under any of the experimental conditions, and plotted in arbitrary units as mean ± SEM. The oligonucleotide primers used are shown in Table S1 (Supplementary Materials). FGF21 amplification with cDNA synthesis was obtained from 1.5 to 2 μg of RNA. FGF21 quantification was performed using TaqMan® Universal PCR Master Mix and the specific TaqMan primers FGF21 (Mm 00840165_g1, Life Technologies, MA, USA). Results are expressed as mean ± SEM.

The total gastrocnemius DNA was isolated using Puregene Cell and Tissue Kit (Qiagen) and was amplified using specific primers for mtCOXII and 18S by real-time PCR using the Power SYBR Green RT-PCR kit (Applied Biosystems). The mtDNA copy number was calculated using 18S amplification as a reference for nuclear DNA content. Real-time PCR was performed with the following primers:
18S Fw: CATTCGAACGTCTGCCCTATCA
18S Rw: GGGTCGGGAGTGGGTAATTTG
COXII Fw: GCCGACTAAATCAAGCAACA
COXII Rw: CAATGGGCATAAAGCTATGG

Total genomic DNA was isolated using Puregene Cell and Tissue Kit (QIAGEN) and was amplified using specific primers of Ms-Dloop1, Ms-COX1, Ms-ND4, Ms-16S, Ms-RNR-S, D–COX1, and D–CytB by real-time PCR using the Power SYBR Green RT-PCR kit (Applied Biosystems). The mtDNA copy number was calculated using Ms-RNR-S and D-RPL32 amplification as a reference respectively for mouse and Drosophila nuclear DNA content. The primer sets for the real-time PCR are listed in Supplementary Table 2.

The total RNA was prepared from gastrocnemius muscles or liver using TRIzol (Invitrogen). Complementary DNA was generated from 0.4 μg of RNA reverse-transcribed with SuperScript III Reverse Transcriptase (Invitrogen). Duplicates of cDNA samples were then amplified on the 7900HT Fast Real-Time PCR System (Applied Biosystems) using the Power SYBR Green RT-PCR kit (Applied Biosystems). All data were normalized to GAPDH expression and plotted in arbitrary units as mean ± SEM. The oligonucleotide primers used are shown in Supplementary Table 4.
IGF1 quantification was performed using TaqMan® Universal PCR Master Mix and the specific TaqMan primers IGF1 class II (Mm 00439559_m1, Life Technologies). The data were normalized to GAPDH expression (Mm 99999915_g1, Life Technologies). miR1 was quantified using single specific RT-qPCR using TaqMan MicroRNA Assays (Applied Biosystems by Thermo Fisher Scientific, Waltham, MA, USA). cDNA synthesis was obtained starting from 5 µl of RNA with the TaqMan MicroRNA Reverse Transcription Kit, and the amplification was subsequently performed with TaqMan Fast Universal PCR Master Mix using 1 µl of cDNA and specific TaqMan primers (miR1 Assay ID 002222). The results are expressed as mean ± SEM.