The largest database of trusted experimental protocols

11 protocols using h4k12ac

1

Characterization of Histone Acetylation Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols
Rabbit polyclonal anti-Sirt6 (Cat#: S4197), mouse monoclonal anti-tubulin-FITC (Cat#:T6074) antibody were purchased from Sigma. Human anti-centromere CREST antibody (Cat#:15–234) was purchased from Antibodies Incorporated (Davis, CA, USA). Cy5-conjugated donkey anti-human IgG (Cat#: 709-605-149) was purchased from Jackson ImmunoResearch Laboratory (West Grove, PA, USA). FITC-conjugated goat anti-rabbit IgG was purchased from Thermo Fisher Scientific (Rockford, IL, USA). Rabbit monoclonal H4K16ac (Cat#: ab109463), rabbit monoclonal H3K56ac (Cat#: ab76307) antibodies were purchased from Abcam (Cambridge, MA, USA). Rabbit polyclonal H3K9ac (Cat#: 9671) and H4K12ac (Cat#: 06–1352) antibodies were purchased from EMD Millipore (MA, USA). And rabbit polyclonal H3K14ac (Cat#: A-4023-050) antibody was purchased from Epigentek Group Inc (Brooklyn, NY, USA).
+ Open protocol
+ Expand
2

Chromatin Remodeling Protein Characterization

Check if the same lab product or an alternative is used in the 5 most similar protocols
Asf1 (Dr. Almouzni), β-actin (Sigma Aldrich A5316), Flag (Sigma Aldrich F3165), γH2AX (Abcam ab2893), HA (Sigma clone 12CA5), HAT1 (Abcam ab12164), HIRA (Abcam ab20655), Histone H3 (Abcam ab7834), H3ac (Merck Millipore, 06-599), Histone H4 (Abcam ab10158), H4K12ac (Merck Millipore 07-595), Hsc70 (Abcam ab19136), Hsp90 (Santa Cruz sc-7947), Importin4 (Abcam ab283887), JMJD1B (Cell Signaling Technology 2621S), NASP (Dr. Almouzni), Topo I (Santa Cruz sc-32736), SetDB1 (Abcam ab12317).
+ Open protocol
+ Expand
3

Western Blot Analysis of Histone Modifications

Check if the same lab product or an alternative is used in the 5 most similar protocols
FLAG and HA epitope tags were detected with horseradish peroxidase (HRP) conjugated anti-FLAG (Sigma, A8592) and anti-HA (Roche, 12013819001), respectively. The α-tubulin antibody is from cell signaling (3878). The following histone antibodies were used: H3K9ac (Millipore, 07–352), H3K27ac (Active Motif, 39133), H3ac (Active Motif, 39139), H3 (Abcam, ab1791), H4K8ac (Millipore, 07–328), H4K12ac (Millipore, 07–595), H4K16ac (Millipore, 07–329), H4ac (Active Motif, 39243), H4 (Abcam, ab7311). All western blots were developed using ECL Plus Western Blotting Detection System (GE healthcare, RPN2132).
+ Open protocol
+ Expand
4

Chromatin Assembly Factor-1 Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
ASF1a/b (11 (link)), CAF-1/p150 (Novus Biologicals #NB500–207A1), DAXX (Santa Cruz #sc-7152), HAT1 (Abcam #ab12164), HIRA (Abcam #ab20655), Histone H3 (Abcam #ab7834), H3K9me1 (Millipore #07–450), H3K9me2 (Millipore, #07–212), H4K12ac (Millipore #07–595), Hsc70 (Abcam #ab19136), Hsp90 (Santa Cruz #sc-7947), Importin4 (Abcam #ab28387), MCM2 (BD Transduction Lab #610700), MCM5 (Bethyl A300–195A), NASP (donated by Dr Almouzni), RPL5 (Abcam #ab74744), RPS3a (Abcam, ab171742), SetDB1 (Abcam #ab12317). For Western blot analysis the primary antibodies were detected with a horseradish peroxidase-conjugated secondary antibody, developed with enhanced chemiluminescence (ECL, Pierce) and exposed onto an X-ray film.
+ Open protocol
+ Expand
5

Comprehensive Antibody Usage Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following antibodies were used in this study: H3K27me3 (Millipore 07-449), H3K27ac (Abcam ab4729, Western blot), H3K27ac (Cell signaling, 8173BC, ChIP), H3K4me1 (homemade EDL), H4K12ac (Millipore, 07-595), P300 (Clone NM11, Active Motif 61401), BRD4 (Bethyl A301-985A50, ChIP), BRD4 (Abcam ab128874, Western blot), Cas9 (Millipore MAC133), H2A.Z (Abcam ab150402), mH2A1 (Abcam ab37264, ChIP), mH2A1 (Millipore 07-219, Western blot), mH2A2 (Homemade, Bernstein Lab23 (link)), H3 (Abcam Ab1791), H4 (Abcam, ab177840), GFP (Roche 11814460001), Beta-Actin (Sigma, A5441), Flag (Sigma, F1804), Mouse IgG – DyLight 680 (Invitrogen SA5-10170), Rabbit IgG DyLight 800 (Invitrogen SA5-10044). The antibodies used in this study are listed in Supplementary Table 2.
+ Open protocol
+ Expand
6

ChIP-qPCR Analysis of Epigenetic Regulators

Check if the same lab product or an alternative is used in the 5 most similar protocols
ChIP assays were carried out using a commercially available kit according to the manufacturer’s instructions (Upstate, Millipore). Briefly, human chondrocytes were fixed, harvested, and sonicated. The sonicated supernatants were diluted with ChIP dilution buffer and precleared with protein G agarose. After removing 1% supernatants as input, the supernatants were incubated with an antibody against Brd3 (Abcam), Brd4 (Abcam), cyclin-dependent kinase 9 (Cdk9) (Santa Cruz Biotechnology, INC), Ser2-phosphorylated RNA polymerase II C-terminal domain (S2P Pol II) (Abcam), H4K5Ac (Millipore), H4K8Ac (Millipore), H4K12Ac (Millipore), and nonspecific IgG (Upstate, Millipore) antibodies overnight at 4 °C with rotation. The protein/DNA complexes and the input were eluted, reversed, and purified. The quantitative analysis of targeted promoter regions was determined by real-time PCR using specific primers (Additional file 1: Table S1), and the results were normalized to the level of input by using the same primers. Each sample for real-time PCR was evaluated by three tests.
+ Open protocol
+ Expand
7

Histone Modulation via SCFA and Inhibitors

Check if the same lab product or an alternative is used in the 5 most similar protocols
Molecular grade SCFAs butyric acid, isobutyric acid, isovaleric acid, propionic acid, and acetic acid, proteomic inhibitor MG132, SIRT1 inhibitors Sirtinol, class-1/2 HDACs inhibitor suberoyanilide hydroxamic acid (SAHA), and EZH2 inhibitor UNC were purchased from Sigma-Aldrich. Antibodies against EZH2, SIRT1, SUV39H1, RNA polymerase II, histone-3 (H3), acetylated histones including H3K27-Ac, H3K9-Ac, H4K12-Ac, and H2B-Ac, repressive histone marks H3K27me3 and H3K9me3, and activating histone methylation mark H3K4me3 were purchased from Millipore.
+ Open protocol
+ Expand
8

Histone Modification Analysis by Western Blot

Check if the same lab product or an alternative is used in the 5 most similar protocols
Lysates were analysed by SDS–PAGE using the following antibodies: polyclonal antibodies (AV94 and AV100) respectively against yeast histone H4 and a C-terminal peptide of H3 (a gift from Dr Alain Verreault, Université de Montréal), Monoclonal anti-H3K9ac (Cell Signaling, C5B11, Cat. No 9649), Phospho-p38 MAPK (Thr180/Tyr182) (Cell Signaling, D3F9, Cat. No 4511) and p44/42 MAPK (Thr202/Tyr204) phospho (Cell Signaling, 9101S), Histone H4K5ac (Active Motif, 39583, 39584), H4K12ac (Active motif, 39165, 39166), Anti-acetyl-histone H4K16Ac (Millipore, Cat. No 07-329), anti-acetyllysine (Immunechem, ICP0380), Anti-TAP (CBP) (Fisher, cab1001). Anti-tubulin (YOL1/34) (Abcam, ab6161), Anti-V5 (Medimab, ab27671). ECL scans of whole membranes are in Supplementary Fig. S10
+ Open protocol
+ Expand
9

Investigating NFAT1 and ACLY Regulation in Cellular Metabolism

Check if the same lab product or an alternative is used in the 5 most similar protocols
The antibodies used were Tubulin (Sigma), NFAT1 (Cell Signaling for Western; Abcam for immunofluorescence), HA (Thermo-Scientific), H3K27ac (Abcam), H4K12ac (Millipore), AMPKα (Cell Signaling Technology), p-phospho-AMPKα T172 (Cell Signaling Technology), IRDye 800CW goat anti-rabbit IgG secondary (Licor), and IRDye 680RD goat anti-mouse IgG secondary (Licor). NFAT1 shRNA were cloned into a pLKO.1 backbone (sense sequence #47: GTGAACTTCTACGTCATCAAT). ACLY shRNA #12 and #13 were published previously (Lee et al. 2014 (link); Sivanand et al. 2017 (link)). siRNA against NFAT1 was a SMARTpool from Dharmacon. CA-NFAT1 (Addgene, plasmid 11792) and wild-type NFAT1 (Addgene, plasmid 11791) were cloned into pLX303. ACLY inhibitor (ACLYi: BMS303141), CsA (TEVA), and ionomycin (Tocris) were dissolved in ethanol. C646 (p300 inhibitor) was dissolved in DMSO. Glucose and sodium acetate stock solutions were purchased from Sigma. GlcNAc (Sigma) was dissolved in water. Fatty acids (palmitate: oleate mix) were conjugated to BSA as described previously (Shah et al. 2016 (link)). Pyruvate was purchased from Gibco, and dimethyl-α-ketoglutarate was purchased from Sigma.
+ Open protocol
+ Expand
10

Histone Modification Analysis Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols
HA (Sigma clone 12CA5), HAT1 (Abcam ab12164), Histone H3 (Abcam ab7834), Histone H4 (Abcam ab10158), H4ac (Millipore 06-866), H4K5ac (Millipore 07-327), H4K8ac (Millipore 06-760), H4K12ac (Millipore 07-595), H4K16ac (Millipore 07-329), Hsp70 (Cell Signalling 4876), Hsp90 (Santa Cruz sc-7947), NASP (Dr Almouzni), PP32 (Abcam ab5991), SET/TAF-Iβ (Abcam ab1183).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!