Cfx96 real time pcr cycler

Manufactured by Bio-Rad

Sourced in United States

The CFX96 real-time PCR cycler is a laboratory instrument designed for quantitative real-time polymerase chain reaction (qRT-PCR) analysis. It provides precise temperature control and optical detection capabilities to facilitate the amplification and quantification of DNA or RNA samples.

Automatically generated - may contain errors

Lab products found in correlation

Qiazol lysis reagent, by Qiagen (2 mentions) Primescript rt reagent kit with gdna eraser, by Takara Bio (2 mentions) E z n a plant rna kit, by Omega Bio-Tek (2 mentions) Cfx manager software, by Bio-Rad (2 mentions) Primescript rt master mix kit, by Takara Bio (2 mentions) Faststart universal sybr green master kit, by Roche (2 mentions) Trizol, by Merck Group (2 mentions) Qscript cdna synthesis kit, by Quanta Biosciences (2 mentions) Qx200 droplet digital pcr system, by Bio-Rad (2 mentions) Reverse transcription kit, by Thermo Fisher Scientific (2 mentions) Rnaiso plus, by Takara Bio (2 mentions) Sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions) Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (1 mentions) Taqman gene expression master mix, by Thermo Fisher Scientific (1 mentions) Purelink rna mini kit, by Thermo Fisher Scientific (1 mentions) Power sybr green master mix, by Thermo Fisher Scientific (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Luna universal qpcr reagent, by New England Biolabs (1 mentions) Sybr premix ex taq tli rnaseh plus kit, by Takara Bio (1 mentions) Sybr premix ex taqtm 2 kit, by Takara Bio (1 mentions)

Close spelling variants of this product

CFX96 (2302 citations) CFX96 cycler (146 citations) CFX96 Real-Time PCR (107 citations) CFX96 real-time PCR system C1000 Thermal Cycler (15 citations) CFX96 real-time PCR thermal cycler (11 citations) CFX96 PCR Cycler (10 citations) CFX96 Thermal Cycler Dice™ real-time PCR system (7 citations) CFX96 touch real-time PCR cycler (6 citations) CFX96 Touch Real-Time PCR Detection System thermal cycler (5 citations) CFX96™ Real-Time PCR Detection System thermal cycler (5 citations)

33 protocols using cfx96 real time pcr cycler

5hmC Enrichment and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

5hmC containing DNA was enriched by the EpiJET 5hmC Enrichment Kit (Thermo Fisher Scientific, K1491BID), according to the manufacturer’s instructions. The enriched DNA was then used for qPCR analysis of the Dux locus. qPCR reactions with target-specific primers included the forward (5′GCTTTGCTACCAGGGAGGAG) and reverse (5′GATCTTGAGCTGTGGGCCTG) primers for Dux region 1 and the forward (5′CTAGCGACTTGCCCTCCTTC) and reverse (5′GCTGATCAAGGAGGGGTTCC) primers for Dux region 2. PCR reactions were performed at 95°C for 10 min followed by 50 cycles at 95°C for 15 s, 57°C for 30 s, and 72°C for 30 s, using Power SYBR Green master mix (Applied Biosystems, 1809579) on a CFX96 real-time PCR cycler (Bio-Rad).
Total RNAs were isolated from cultured cells by using the PureLink RNA Mini Kit (Ambion). The SuperScriptIII reverse transcriptase (Invitrogen, 18080051) was used for reverse transcription of RNA, according to the manufacturer’s instructions. Real-time qPCR reactions with target-specific primers (available upon request) were performed at 50°C for 2 min and 95°C for 10 min followed by 50 cycles at 95°C for 15 s and 60°C for 1 min using TaqMan Gene Expression master mix (Applied Biosystems, 4369016) on a CFX96 real-time PCR cycler (Bio-Rad). The cDNA levels of target genes were analyzed using comparative C_t methods and normalized to internal standard, β-actin.

Huang Z., Yu J., Cui W., Johnson B.K., Kim K, & Pfeifer G.P. (2021). The chromosomal protein SMCHD1 regulates DNA methylation and the 2c-like state of embryonic stem cells by antagonizing TET proteins. Science Advances, 7(4), eabb9149.

+ Open protocol

+ Expand

Quantification of SARS-CoV-2 Viral RNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from infected cells using the PureDireX Total RNA Isolation Kit (Bio-Helix, New Taipei City, Taiwan) according to the manufacturer’s instructions. The eluted RNAs were quantified, normalized to 20 ng/mL, and stored at −80 °C until use. Samples were assayed with a one-step RT-qPCR protocol using the Luna^® Probe system (New England Biolabs, Ipswich, MA, USA) and the following primers targeting the nsp4, E1, and actin as a reference gene for normalization: nsp4F, TCACTCCCTGTTGGACTTGATAGA; nsp4R, TTGACGAACAGAGTTAGGAACATACC; nsp4P Texas Red/AGGTACGCGCTTCAAGTTCGGCG/BHQ2; E1F, AAGCTYCGCGTCCTTTACCAAG; E1R, CCAAATTGTCCYGGTCTTCCT, E1P FAM/CCAATGTCYTCMGCCTGGACACCTTT/BHQ-1; actin F, GGATGCAGAAGGAGATCACTG; actin R, CGATCCACACGGAGTACTTG; and actin HEX/CCCTGGCACCCAGCACAATG/BHQ1. Each reaction (20 μL) contained 10 μL of 2× master mix, 200 nM primers, 200 nM probes, and 60 ng of RNA. Reactions were performed in a CFX96 real-time PCR cycler (BioRad) under the following cycling conditions: 15 min of reverse transcription at 55 °C, followed by a denaturation step at 95 °C for 3 min, and 40 cycles of 95 °C for 15 s and 60 °C for 1 min. The fold changes in the inhibitor-treated samples, when compared to the levels in the untreated samples, were calculated using Pfaffl’s (2001) method [21 (link)].

López L.S., Calvo E.P, & Castellanos J.E. (2023). Deubiquitinating Enzyme Inhibitors Block Chikungunya Virus Replication. Viruses, 15(2), 481.

+ Open protocol

+ Expand

RNA Isolation and qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA of fpEC was isolated using RNeasy Mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Cell monolayer was washed using PBS, and 0.7 mL of QIAzol lysis reagent (Qiagen, Germantown, MD, USA) was added to lyse the cells, and RNA was isolated using the kit. The concentration and the purity of obtained RNA was quantified by measuring 260/280 ratio using the Scandrop 250 (Analytik Jena Jena, Germany), and RNA integrity was examined by gel electrophoresis. cDNA was made using Luna universal reverse transcriptase PCR kit (New England Biolabs Frankfurt, Germany). Real-time quantitative PCR (qPCR) was carried out by using Luna universal qPCR reagent (New England Biolabs, Frankfurt, Germany) in CFX384 or CFX96 real time PCR cycler (Bio-Rad Laboratories, Vienna, Austria). All primer sequences used in this study are listed in Table 1. All primers were designed by crossing the exons to avoid the amplification of genomic DNA. Primer efficiency was verified by standard calibration curves. Gene expression levels were normalized to HPRT1 (Hypoxanthine Phosphoribosyl transferase 1) house-keeping genes, and the results were calculated using the 2^−ΔΔCT method.

George M., Lang M., Gali C.C., Babalola J.A., Tam-Amersdorfer C., Stracke A., Strobl H., Zimmermann R., Panzenboeck U, & Wadsack C. (2023). Liver X Receptor Activation Attenuates Oxysterol-Induced Inflammatory Responses in Fetoplacental Endothelial Cells. Cells, 12(8), 1186.

+ Open protocol

+ Expand

Tomato Leaf RNA Extraction and qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from tomato leaves using an E.Z.N.A.® Plant RNA Kit (Omega Bio–Tek, Doraville, GA, USA) according to the manufacturer’s instructions. The total RNA was then reverse–transcribed using a PrimeScript^TM RT reagent kit with gDNA Eraser (Takara, Shiga, Japan) in a 20–μL reaction mixture containing 1 μL of total RNA from each individual sample. Real–time PCR was performed on a CFX96™ real–time PCR cycler (Bio–Rad, Hercules, CA, USA) and a SYBR Premix Ex Taq (TliRNaseH Plus) Kit (Takara). Initial denaturation at 95 °C for 30 s was followed by 40 cycles of 95 °C for 5 s, 58 °C for 30 s, and a melting curve of 65–95 °C. Primers for the actin gene were used as an internal control. Primers for psbA and actin were designed as described by Wu et al. [55 (link)]. Primers for the pbgD and Chlase genes were designed using Primer3, version 4.0.0 (website software), with the primer length set at 20 − 24 bp; melting temperature of 58 − 62 °C; CG content, 30 − 70 %; and product size, 150–250 bp. All samples were analyzed three times.

Li J., Hu L., Zhang L., Pan X, & Hu X. (2015). Exogenous spermidine is enhancing tomato tolerance to salinity–alkalinity stress by regulating chloroplast antioxidant system and chlorophyll metabolism. BMC Plant Biology, 15, 303.

+ Open protocol

+ Expand

Quantification of Fusobacterium species

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted from frozen tissue samples, pretreated with QIAzol Lysis reagent (Qiagen, Valencia, CA) and chloroform based on manufacturer’s recommendations as described previously^{36 (link),40 (link)}. Probe-based quantitative real-time PCR was performed using Bio-Rad CFX96 real-time PCR cycler (BioRad, CA). Following probe-based primer were used: Fusobacterium spp.^{44 (link)}; F. nucleatum^{9 (link)}; prostaglandin transporter (PGT), also known as solute carrier organic anion transporter family, member 2A1 (SLCO2A1), as endogenous control for normalization as previously described^{8 (link)}. Primer and probe sequences are provided in Supplementary Table S2. Ct-values for Fusobacterium spp. and F. nucleatum were set to 40 if PCR analyses revealed a negative result. Normalization was performed using 2^deltaCt-method. The values of the samples with undetectable Fusobacterium spp. and F. nucleatum were set to the lowest measurable normalized values.

Boehm E.T., Thon C., Kupcinskas J., Steponaitiene R., Skieceviciene J., Canbay A., Malfertheiner P, & Link A. (2020). Fusobacterium nucleatum is associated with worse prognosis in Lauren’s diffuse type gastric cancer patients. Scientific Reports, 10, 16240.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA extraction and cDNA amplification were performed according to the above method. The Quantitative real-time PCR (qRT-PCR) was run on a CFX96 real-time PCR cycler (Bio-Rad Laboratories, Hercules, CA, USA) using SYBR Premix Ex Taq^TM II Kit (Takara, Beijing, China), with the following cycling conditions: 30 s at 95°C and 40 cycles of 5 s at 95°C and 30 s at 60°C. The Actin gene was used as an internal reference. Relative mRNA ratios were calculated using the 2^−ΔΔCT (Livak and Schmittgen, 2001 (link)). The specific primers used for qPCR are listed in Supplementary Table 1.

Zhu Z., Quan R., Chen G., Yu G., Li X., Han Z., Xu W., Li G., Shi J, & Li B. (2022). An R2R3-MYB transcription factor VyMYB24, isolated from wild grape Vitis yanshanesis J. X. Chen., regulates the plant development and confers the tolerance to drought. Frontiers in Plant Science, 13, 966641.

+ Open protocol

+ Expand

Quantification of Nitric Oxide and ET-1 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The NO concentration in the cell culture media was quantified using a commercial NO assay kit (nitrate reductase method) from Nanjing Jiancheng Bioengineering Institute (Jiangsu Province, China). Total RNA was isolated from cells using TRIzol reagent according to the manufacturer’s protocol (TaKaRa, Japan). Total RNA (0.5 μg) was converted into first-strand complementary DNA in a 20-μl reaction mixture using a One-step Reverse Transcriptase kit (TaKaRa). ET-1 expression was determined by real-time quantitative PCR (forward: 5'-CAAACCGATGTCCTCGTA-3' and reverse: 5'-ACCAAACACATTTCCCTATT-3'). The quantitative expression of the genes was normalized against glyceraldehyde 3-phosphate dehydrogenase (GAPDH; forward: 5'-GATTTGGCCGTATCGGAC-3' and reverse: 5'-GAAGACGCCAGTAGACTC-3'). The reactions were carried out using SYBR Green as a fluorescence dye on a real-time PCR thermal cycler (CFX96 Real-Time PCR cycler; Bio-Rad Laboratories, CA, United States). The 2^−△△CT method was used for relative expression analysis. The experiment was repeated three times.

Fan F., He J., Su H., Zhang H., Wang H., Dong Q., Zeng M., Xing W, & Sun X. (2020). Tribbles Homolog 3-Mediated Vascular Insulin Resistance Contributes to Hypoxic Pulmonary Hypertension in Intermittent Hypoxia Rat Model. Frontiers in Physiology, 11, 542146.

+ Open protocol

+ Expand

Thermal-Shift Assay for NADP+ Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols

Thermal-shift assays were performed on a CFX96 Real-Time PCR Cycler (Bio-Rad Laboratories). In these experiments, 1 μl of SYPRO Orange (Sigma-Aldrich, diluted from 5,000 × stock into Milli-Q), 8 μl protein (1.0 mg ml⁻¹), and 1 μl buffer (1 M citrate buffer (pH 5.75)) were mixed on ice in a white 96-well PCR plate (Bio-Rad Laboratories). To evaluate the effect of NADP⁺ binding, 1 μl of 5,000 × SYPRO Orange, 8 μl protein (1.0 mg ml⁻¹) and 1 μl buffer (1 M citrate buffer (pH 5.8)) containing 10 mM NADP⁺ were mixed. Fluorescence was measured as temperature increased from 25 to 85 °C in 0.5 °C steps (excitation, 450–490 nm; detection, 560–580 nm). All measurements were performed three times. Data evaluation and melting-point determination were conducted using the Bio-Rad CFX Manager software.

Takao H., Hirabayashi K., Nishigaya Y., Kouriki H., Nakaniwa T., Hagiwara Y., Harada J., Sato H., Yamazaki T., Sakakibara Y., Suiko M., Asada Y., Takahashi Y., Yamamoto K., Fukuyama K., Sugishima M, & Wada K. (2017). A substrate-bound structure of cyanobacterial biliverdin reductase identifies stacked substrates as critical for activity. Nature Communications, 8, 14397.

+ Open protocol

+ Expand

Quantitative PCR Analysis of Cytokine Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from tissue samples by using RNAiso Plus reagent and cDNA was reverse transcribed by using PrimeScript™ RT Master Mix kit (both from TaKaRa, Shiga, Japan) following the manufacturer’s instructions. The quantitative PCR of innate and adaptive cytokines (IL-25, IL-33, TSLP, IFN-γ, IL-4, IL-5, IL-13 and IL-17A) was performed by using the FastStart Universal SYBR Green Master kit (Roche, Mannheim, Germany) with appropriate primers. GAPDH was used as an endogenous reference. The sequences of primers are listed in Additional file 1: Table S2. Amplification was carried out on the CFX96™ Real-Time PCR cycler (Bio-Rad, CA, USA) using the cycling conditions as follows: 10 min’ initial denaturation at 95 °C, 40 cycles consisted of 10 s at 95 °C and 30 s at 60 °C. The melting curve was obtained from 60 to 95 °C (0.5 °C/s). Expression of target gene was expressed as fold increase relative to the expression of GAPDH. The mean value of the replicates for each sample was calculated and expressed as cycle threshold (Ct). The amount of gene expression was then calculated as the difference (ΔCt) between the Ct value of target gene and the Ct value of GAPDH. Fold changes in target gene mRNA were determined as 2^−ΔCt [36 (link)].

Zheng R., Wang D., Wang K., Gao W.X., Yang Q.T., Jiang L.J., Zhou M., Cao Y.J., Shi J, & Sun Y. (2018). Elevated expression of IL-17RB and ST2 on myeloid dendritic cells is associated with a Th2-skewed eosinophilic inflammation in nasal polyps. Clinical and Translational Allergy, 8, 50.

+ Open protocol

+ Expand

RNA Extraction and Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Cells were harvested, washed once with PBS and RNA was isolated with TRIZOL (Sigma). cDNA was synthesized (qScript cDNA synthesis kit, Quanta Biosciences). Real-Time reactions were performed in triplicate using KAPA SYBR FAST qPCR Kit (2X) (KAPA-Biosystems) following manufacture's instructions on a CFX96 Real Time PCR Cycler (Bio-Rad). The reactions were normalized to β-actin or Gapdh, using the ΔΔ threshold cycle (Ct) method. Specificity of the primers was checked by dissociation curves. Primer sequences are provided in Supplementary Table 1.

Abboud-Jarrous G., Priya S., Maimon A., Fischman S., Cohen-Elisha M., Czerninski R, & Burstyn-Cohen T. (2017). Protein S drives oral squamous cell carcinoma tumorigenicity through regulation of AXL. Oncotarget, 8(8), 13986-14002.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!