The extracted RNA was treated with DNase (Promega) according to the manufacture’s protocol. Reverse transcription (RT-PCR) was performed with 1000 ng of DNase-treated RNA using the reverse transcriptase enzyme M-MLV (Promega). The qPCRs were performed using a Brilliant II SYBR Green QPCR Master Mix (Agilent) following the protocol provided by the manufacturer. Briefly, 20 μl reaction volumes in 96-well plates were analyzed in LightCycler 480 (Roche Diagnostics) under the following conditions: initial 10 min denaturation at 95 °C, followed by 45 cycles at 95 °C for 15 s, and 60 °C for 60 s. Following primer pairs were used for cDNA amplification: CDH11 (forward 5′- AGAGAGCCCAGTACACGTTGA -3′, reverse 5′- TTGGCATGATAGGTCTCGTGC -3′), PLAUR (forward 5′- TGTAAGACCAACGGGGATTGC -3′, reverse 5′- AGCCAGTCCGATAGCTCAGG -3′), and MEST (forward 5′- CGCAGGATCAACTTCTTTC -3′, reverse 5′- CATCAGTCGTGTGAGGATGG -3′). Normalization was performed as above. The qPCRs were performed in triplicates.
Dnase
Manufactured by Promega
Sourced in United States, Italy, Spain, France, Germany, United Kingdom, Denmark
DNase is a type of enzyme that catalyzes the degradation of DNA. It is used in various laboratory applications to remove DNA from samples, such as in DNA extraction and purification procedures.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (132 mentions)
Trizol, by Thermo Fisher Scientific (69 mentions)
Dnase, by Thermo Fisher Scientific (31 mentions)
Rneasy mini kit, by Qiagen (25 mentions)
M mlv reverse transcriptase, by Promega (23 mentions)
Sybr green pcr master mix, by Thermo Fisher Scientific (20 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (19 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (14 mentions)
Agilent 2100 bioanalyzer, by Agilent Technologies (13 mentions)
Tri reagent, by Merck Group (13 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (13 mentions)
Nanodrop spectrophotometer, by Thermo Fisher Scientific (13 mentions)
Superscript 2 reverse transcriptase, by Thermo Fisher Scientific (11 mentions)
Cfx96 real time pcr detection system, by Bio-Rad (10 mentions)
Steponeplus real time pcr system, by Thermo Fisher Scientific (9 mentions)
Iscript cdna synthesis kit, by Bio-Rad (9 mentions)
Lightcycler 480, by Roche (9 mentions)
Nanodrop nd 1000 spectrophotometer, by Thermo Fisher Scientific (9 mentions)
Superscript 3, by Thermo Fisher Scientific (8 mentions)
T7 rna polymerase, by Promega (7 mentions)
479 protocols using dnase
1
Quantitative gene expression analysis
2
Quantitative RT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted with TRIzol (Sigma #T9424) and subjected to DNAse (Promega) treatment. DNAse-treated RNA was used to prepare complementary DNA using random hexamers and the ImProm-II Reverse Transcription Kit (Promega), according to the manufacturer’s instructions. The complementary DNA was amplified using Radiant SYBR Green PCR mix (Alkali Scientific Inc.) in Roche LightCycler 96 instrument, and data were analyzed using LightCycler 480 Software, version 1.5 (https://lifescience.roche.com/global/en/products/product-category/lightcycler.html#4 ). The mRNA expression level for the genes of interest was normalized to that of 18S ribosomal RNA, and the normalized mRNA level was plotted using GraphPad Prism 9 software (www.graphpad.com ). The primers used for qRT-PCR analyses are listed in Table S1 .
3
Quantitative Analysis of Cellular Proliferation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells, plated on coverslips, were incubated with 10 µg/ml BrdU (Sigma) for a 24 hours labeling period (or 60 hours for cen2 and cen3 fibroblasts); cells were fixed with 4% paraformaldheyde for 10 minutes and permeabilized with 0.2% TritonX-100 for 10 minutes at room temperature; after incubation with a blocking solution containing 2.5% BSA and 1% gelatin from cold water fish skin (SIGMA), cells were incubated with a mixture containing primary antibody (anti-BrdU 1∶20), DNase (1∶10, Stock concentration: 1 U/µl, Promega), DNase buffer and MgCl2 at 3 mM final concentration for 45 minutes at room temperature in a dark humidified chamber. After washing, coverslips were incubated with a secondary antibody. DAPI staining was used to detect nuclei; proliferating cells were used as a control. At least 100–300 cells (or more where indicated) were screened for a statistically significant analysis.
4
Transcriptional Analysis of Shigella flexneri
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated with TRIzol (Invitrogen, Carlsbad, CA, USA, 15596108) from S. flexneri cultured to the middle logarithmic growth phase (OD600 = 0.6), and remaining DNA was digested with DNase (Promega, Madison, WI, USA, M6101). ODs were determined at 260 nm and 280 nm using a UV-Vis spectrophotometer to assess RNA concentration. DNase-treated total RNA (not more than 10 μg) was reverse-transcribed into cDNA using a reverse transcription kit (Promega, Madison, WI, USA, K1005S) in accordance with the manufacturer's instructions. cDNA was synthesized using 2 μg of total RNA and a Promega Reverse Transcription System. It was then diluted (1:5) in nuclease-free water. Primers were designed based on the Ssr54 sequence (Supplementary Table 1 for further details) and used the cDNA as PCR template. PCR was performed using ExTaq Mix (Takara Biochemicals, Beijing, China, RR001Q) under the following thermal cycling conditions: 10 min at 95°C for pre-incubation, followed by 30 cycles of amplification (30 s at 95°C, 30 s at 55°C, and 30 s at 72°C) (Absin Bioscience, Foster City, CA, USA). RNA preparation and qRT-PCR analysis were repeated at least three times.
5
Verification of Lox-P Site Integration
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
rSV40-containing medium was treated with DNase (1 μL/10 μL medium DNase [1 unit/μL]) (Promega, Benelux, Leiden) for 30 min at 37°C. DNase was inactivated at 95°C for 5 min. A region encompassing the Lox-P site was amplified using a primer in the VP1 sequence and a primer in the luciferase, GFP, or hUGT1A1 gene sequence, respectively, followed by sequencing of the resulting amplicons. Primers used for the different constructs are listed in Table 2 .
Primers Used to Amplify the Lox-P-Containing Region
| Primer | Sequence (5'-3') |
|---|---|
| VP2 | TGGGCAGCCTATGATTGGAA |
| Luciferase | GCGGAAAGATCGCCGTGTAA |
| GFP | TTCGTAGAGCAGCACGAGAC |
| hUGT1A1 | AGCCCACAAATCCAAGACCC |
6
Quantitative RNA Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total cellular RNA was extracted and purified from liver and spleen samples using TRI ReagentTM Solution (Invitrogen, Paris, France) and then treated with DNase (Promega, Charbonnières-les-Bains, France) (1 U DNase/µg total RNA). RNA from bone marrow cells (BM) was extracted using the Nucleospin® RNA kit (Macherey-Nagel, Hoerdt, France). Reverse transcription was performed with a high-capacity cDNA reverse transcription kit (Applied Biosystems, Villebon-sur-Yvette, France) according to the manufacturer’s instructions.
Quantitative PCR amplifications were carried out in duplicate using Power SYBR® green PCR master mix (Applied Biosystems), 0.3 µM primers, and 2 µl of cDNA in a final volume of 10 µl, in 384-well optical plates, using a CFX384 TouchTM real-time PCR detection system (Bio-Rad, Marnes-la-Coquette, France). Gene-specific primers (Additional file1 : Table S1) were synthesized by Sigma-Aldrich (Lyon, France). Expression levels of target genes were normalized by comparison to expression of murine 18S rRNA. Results were expressed as 2–ΔΔCq referring to the fold induction in relation to the mean quantification cycle obtained with DPBS-treated mice.
Quantitative PCR amplifications were carried out in duplicate using Power SYBR® green PCR master mix (Applied Biosystems), 0.3 µM primers, and 2 µl of cDNA in a final volume of 10 µl, in 384-well optical plates, using a CFX384 TouchTM real-time PCR detection system (Bio-Rad, Marnes-la-Coquette, France). Gene-specific primers (Additional file
7
Quantification of Lipid Biosynthesis Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNA was extracted using a Qiagen RNeasy Mini Kit (catalog 74104), treated with DNase (Promega, M6106), and repurified to remove DNase. One microgram of RNA was used for cDNA synthesis (Bio-Rad, 1708890). No–reverse transcriptase and no-RNA controls were included for each sample. The qPCR was performed with 2× SYBR Green Master Mix (Bio-Rad), 0.5 μM primer (forward plus reverse), and diluted cDNA. qPCR was carried out with n = 3 technical replicates and at least 6 biological replicates per genotype. All values were normalized to the reference genes Hprt and β-actin. The following primers were used: Dyrk1b, forward TAGAGCGCTATGAGATTGACTCTC, reverse TAGCTCAATCTGTGCCTGGTTCA; Srebp1, forward TGACCCGGCTATTCCGTGA, reverse CTGGGCTGAGCAATACAGTT; Srebp2, forward TTCCAACTCTCCTCCTGTGGCT, reverse CCAGCACAAATAAGCAGGTTTGTA; Fasn, forward GGAGTTCTCAGGCCGGGATA, reverse GGGTACATCCCAGAGGAAGTCA; Acc1, forward TGGGGATCTCTGGCTTACAGG, reverse AGCCAGACATGCTGGATCTCAT; Hmgcr, forward AAGACTGTGGTTTGTGAAGCCGTCA, reverse TTGTAGCCGCCTATGCTCCCAG; Hprt, forward TGTTGTTGGATATGCCCTTG, reverse GCGCTCATCTTAGGCTTTGT. The primers for IL1β, TNFα, IL6, and Col1a1 were reported previously (50 (link)).
8
Brain Tissue Homogenization for SDS-PAGE
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For SDS PAGE analysis brain tissue was homogenised (10 mg/100 μl buffer) in 10 mM Tris, pH7.4, 150 mM NaCl, 0.1% (w/v) SDS, DNase (50 Units; Promega), 1X DNase buffer and protease inhibitors using a plastic homogeniser in 1.5 mL reaction tubes. Samples were then homogenised at 1000 rpm until homogenous. Samples were then incubated at 37 °C for 1 h to digest DNA.
9
Fractionation of Nuclear Components
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were washed with cold PBS and treated with hypotonic buffer A (15 mM KCl, 10 mM Hepes pH 7.5, 1.5 mM MgCl2, 0.5 mM DTT, 0.1 mM AEBSF) and centrifuged (5000×g, 10min). Pellet (crude nuclei) was purified by using a “sucrose cushion” (Sucrose 1.5 M, 25 mM KCl, 50 mM Hepes pH 7.5, 5 mM MgCl2, 0.5 mM DTT, 0.1 mM AEBSF) and centrifuged (10000×g, 45min). To acquire the nucleoplasmic fraction (NP) purified nuclei were treated with buffer B (10 mM Hepes pH 7.5, 150 mM NaCl, 300 mM sucrose, 3 mM MgCl2, 0.5% Triton X-100, 0.5 mM DTT, 0.1 mM PMSF) and centrifuged for 15min at 10000×g. Pellets were washed, resuspended in buffer B, and incubated at 32 °C for 10min with RNAse (0.4 μg; Macherey-Nagel, Duren, Germany) and then centrifuged at 10000×g for 10min in order to receive the RNA-rich fraction (RN). The remaining pellets were resuspended in buffer B and incubated at 37 °C for 10min with DNAse (0.5 μg; Promega, Madison, WI, USA) and centrifuged at 10000×g for 10min in order to receive the DNAse-treated fraction (DN). Finally, to receive the insoluble nuclear matrix fraction (NM), pellets were treated with 2 M NaCl in 2%SDS and sonicated (Vibra Cell, Sonics and Materials, USA).
10
Barley Transcriptome RNA-seq Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from frozen barley leaves by the phenol/chloroform method, followed by precipitation with 8 M LiCl (Oñate-Sánchez and Vicente-Carbajosa, 2008 (link)) and digested with DNase (Promega). Using poly-T oligo-attached magnetic beads, mRNAs were purified from the total RNA. Then, the mRNAs were fragmented and cDNA was synthesized using random hexamer-primers, DNA polymerase I and RNase H. The double-stranded cDNAs were purified with magnetic beads and ligated to adaptors for Illumina sequencing. The quality and quantity of the library was verified using an Agilent 2100 Bioanalyzer and an ABI StepOnePlus Real-Time PCR system, respectively. The cDNA libraries were sequenced using the Illumina HiSeq2000 platform by the Beijing Genomics Institute (BGI). More than 10M single-end reads were obtained for each sample (three biological replicates). Raw reads in fastq format were firstly filtered and reads with adaptor sequences and low quality reads were removed. RNA-seq data are available on ArrayExpress database at EMBL-EBI1 under accession number E-MTAB-6565 .
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!