Dnase
DNase is a type of enzyme that catalyzes the degradation of DNA. It is used in various laboratory applications to remove DNA from samples, such as in DNA extraction and purification procedures.
Lab products found in correlation
479 protocols using dnase
Quantitative gene expression analysis
Quantitative RT-PCR Analysis of Gene Expression
Quantitative Analysis of Cellular Proliferation
Transcriptional Analysis of Shigella flexneri
Verification of Lox-P Site Integration
Primers Used to Amplify the Lox-P-Containing Region
Primer | Sequence (5'-3') |
---|---|
VP2 | TGGGCAGCCTATGATTGGAA |
Luciferase | GCGGAAAGATCGCCGTGTAA |
GFP | TTCGTAGAGCAGCACGAGAC |
hUGT1A1 | AGCCCACAAATCCAAGACCC |
Quantitative RNA Expression Analysis
Quantitative PCR amplifications were carried out in duplicate using Power SYBR® green PCR master mix (Applied Biosystems), 0.3 µM primers, and 2 µl of cDNA in a final volume of 10 µl, in 384-well optical plates, using a CFX384 TouchTM real-time PCR detection system (Bio-Rad, Marnes-la-Coquette, France). Gene-specific primers (Additional file
Quantification of Lipid Biosynthesis Genes
Brain Tissue Homogenization for SDS-PAGE
Fractionation of Nuclear Components
Barley Transcriptome RNA-seq Protocol
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!