Trans ferman nk2 micro manipulators

Mouse transgenesis was performed as previously described [24 (link)]. In brief, embryos for microinjection were collected from the oviducts of superovulated donor females (100% C57BL6/NRj background, Janvier Labs (SE-ZYG-CNP)). Microinjections were carried out with the help of an Axio Observer.D1 microscope (Zeiss) and microinjector devices CellTram and FemtoJet with TransferMan NK2 micromanipulators (Eppendorf). A premixed solution containing the sgRNA (50 ng/µl), Cas9 mRNA (50 ng/µl; TriLink Biotechnologies), Cas9 protein (30 ng/µl; PNA Bio Inc) and the ssODNs(100 ng/µl; IDT) was injected into the male pronucleus with injection capillaries (BioMedical Instruments, BM 100F-10; type PI-1.6) [25 (link)]. One day after the microinjection, 2-cell stage embryos were transferred into the oviducts of pseudo-pregnant foster females.

A NR3C1 specific MAO was designed to bind the 5′UTR upstream of the translation initiation site in the rhesus macaque NR3C1 gene (XM_015141112.1: TGGAGTCCATCAGTGAATATCAACT), thereby inhibiting its translation. A MAO recognizing a splice site mutant of the human hemoglobin beta-chain (HBB) gene (AY605051: CCTCTTACCTCAGTTACAATTTATA) was used as a standard (STD) control. Both the NR3C1 and STD MAOs were synthesized with a 3′-carboxyfluorescein tag to aid in visualization during embryo microinjection. Oocytes were collected at 6 h or 36 h following hCG injection to rhesus macaque females undergoing a COS protocol. The MAOs were reconstituted in embryo grade water (Sigma- Aldrich, W1503) and microinjected using a CellTram vario, electronic microinjector and Transferman NK 2 Micromanipulators (Eppendorf, Hauppauge, New York, USA). The MAO concentration (0.3 mM) was chosen based on previous reports that this concentration of STD MAO did not impact blastocyst formation rates in both mice^{41 (link)} and rhesus macaques^{42 (link)}.

The microinjection system consisted of a Zeiss inverted microscope, an Eppendorf Femtojet 4i Injector, a pair of Eppendorf Trans-ferman NK2 micro manipulators. The injector was set to auto mode, the injection time was 0.1 s, the compensation pressure was 15 and the injection pressure was 500. Needles were pulled from borosilicate glass with filament (BF150–75-10) using a Sutter Flaming/Brown Micropipette Puller. Injection solutions (2 μl) were loaded into the needle with an Eppendorf loading pipet Microloader (930001007) from the back. The holding pipets were Eppendorf VacuTip I (5195000036). Embryos were stored in pre-warmed M2 medium on a slide prior to and during microinjection.