Rodent gapdh control reagent

Manufactured by Thermo Fisher Scientific

Sourced in Germany, United States

The Rodent GAPDH Control Reagents are a set of reagents designed to serve as a control for the detection and quantification of the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene in rodent samples. GAPDH is a commonly used endogenous control gene for gene expression analysis. These control reagents provide a reliable reference point for normalizing gene expression data obtained from rodent biological samples.

Automatically generated - may contain errors

Lab products found in correlation

15 protocols using rodent gapdh control reagent

Quantification of Gene Expression by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

q‐RT‐PCR was performed using an ABI StepOnePlus (Applied Biosystems, Foster City, CA, USA). We used the following primer sets and probes: human AES primers (F, forward, 5′‐ TCCCTTTTCTTTGACAGATGGG ‐3′; and R, reverse, 5′‐ AGGAGTCCGAGGTGGTGAATT ‐3′) and probe (5′‐ CTCCTCGCACCTACCCCAGCAACTC ‐3′), mouse Aes primers (F, 5′‐ GGCGGAAATTGTGAAGAGGCT ‐3′; R, 5′‐ CTTGGCTCTCTCGATGGCTC ‐3′) and probe (5′‐ TTTGCGCCCAGGTTCTGCCC ‐3′).
Levels of human ribosomal S18 RNA, human ACTB, and mouse Gapdh were determined using Taqman Ribosomal RNA, human β‐actin and rodent GAPDH Control Reagents (Applied Biosystems). Reactions were prepared using Taqman Universal PCR Master Mix (Applied Biosystems). Relative transcript levels were calculated by the comparative C_T method (ABI User Bulletin #2). Primers used were as follows, HES1 (111 bp); F, 5′‐ TCAACACGACACCGGATAAA ‐3′ and R, 5′‐ TCAGCTGGCTCAGACTTTCA ‐3′, PSA (74 bp); F, 5′‐ GGAAATGACCAGGCCAAGAC ‐3′ and R, 5′‐ CAACCCTGGACCTCACACCTA ‐3′.

Okada Y., Sonoshita M., Kakizaki F., Aoyama N., Itatani Y., Uegaki M., Sakamoto H., Kobayashi T., Inoue T., Kamba T., Suzuki A., Ogawa O, & Taketo M.M. (2017). Amino‐terminal enhancer of split gene AES encodes a tumor and metastasis suppressor of prostate cancer. Cancer Science, 108(4), 744-752.

+ Open protocol

+ Expand

Stress response biomarkers in mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fkbp5 gene expression, as biomarker of depression and stress-related disorders (Figure 5), was analyzed in the hippocampus from the mice subjected to CMS and immunologically stressed (Poly I:C). To confirm the role of CB2R in HPA axis, nuclear receptor subfamily 3 group C member 1 (Nr3c1) and corticotropin releasing hormone (Crf ) gene expressions were analyzed in immunologically stressed (Poly I:C) mice. Interleukin(Il) 1β and Bdnf gene expressions were analyzed for stress induced neuro-immune reaction in the mice. Total RNA was extracted from the brain tissue with RNeasy Mini Kit (QIAGEN, Hombrechtikon, Switzerland). cDNA was synthesized with Revertra Ace (Toyobo, Tokyo, Japan) and oligo dT primer from RNA. Expression of target genes was analyzed with an ABI PRISM 7900 HT Sequence Detection System (Applied Biosystems, Foster City, CA, USA) with the TaqMan gene expression assays for Fkbp5 (Mm00487406_m1), Nr3c1 (Mm00433832_m1), Crf (Mm001293920_m1) and Il1b (Mm00434228_m1). Rodent GAPDH Control Reagents (#4308313, Applied Biosystems) was used to normalize the target gene expression. TaqMan assay was performed in 10 µL reaction volumes. Measurement of threshold cycle (Ct) was the average of four replicates.

Ishiguro H., Horiuchi Y., Tabata K., Liu Q.R., Arinami T, & Onaivi E.S. (2018). Cannabinoid CB2 Receptor Gene and Environmental Interaction in the Development of Psychiatric Disorders. Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry, 23(8), 1836.

+ Open protocol

+ Expand

Biomarkers of Stress and Depression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Fkbp5 gene expression, as biomarker of depression and stress-related disorders (Figure 5), was analyzed in the hippocampus from the mice subjected to CMS and immunologically stressed (Poly I:C). To confirm the role of CB2R in HPA axis, nuclear receptor subfamily 3 group C member 1 (Nr3c1) and corticotropin releasing hormone (Crf) gene expressions were analyzed in immunologically stressed (Poly I:C) mice. Interleukin(Il) 1β and Bdnf gene expressions were analyzed for stress induced neuro-immune reaction in the mice. Total RNA was extracted from the brain tissue with RNeasy Mini Kit (QIAGEN, Hombrechtikon, Switzerland). cDNA was synthesized with Revertra Ace (Toyobo, Tokyo, Japan) and oligo dT primer from RNA. Expression of target genes was analyzed with an ABI PRISM 7900 HT Sequence Detection System (Applied Biosystems, Foster City, CA, USA) with the TaqMan gene expression assays for Fkbp5 (Mm00487406_m1), Nr3c1 (Mm00433832_m1), Crf (Mm001293920_m1) and Il1b (Mm00434228_m1). Rodent GAPDH Control Reagents (#4308313, Applied Biosystems) was used to normalize the target gene expression. TaqMan assay was performed in 10 μL reaction volumes. Measurement of threshold cycle (Ct) was the average of four replicates.

+ Open protocol

+ Expand

mRNA Isolation and Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

mRNA isolation was performed using the RNeasy Plus Mini Kit (Qiagen, Venlo, Netherlands) according to the manufacturer's instructions. RNA concentration and quality was checked using the Agilent RNA 6000 Pico Kit (Agilent Technologies, Santa Clara, CA, USA) again, according to the manufacturer's instructions. The mean RNA integrity number was 8.2. Reverse transcription was performed using the High Capacity cDNA Reverese Transcription kit (Applied Biosystems, Life Technologies, Carlsbad, CA, USA) according to the manufacturer's instructions. TaqMan Gene Expression Assays (Applied Biosystems, Life Technologies, Carlsbad, CA, USA) were run for following genes: Aire (Mm0047746_m1), Psmb11 (Mm00613641_s1), Ins1 (Mm01950294_s1), Ins2 (Mm00731595_gH), Padi1 (Mm00478062_,1), Padi2 (Mm00447020_m1), Padi3 (Mm00478075_m1), Padi4 (Mm01341658_m1) and Padi6 (Mm00462201_m1). Ct values were normalized to Gapdh (Rodent gapdh control reagents, Applied Biosystems, Life Technologies, Carlsbad, CA, USA) by the formula 2^{-Δct(gene-gapdh)}.

Engelmann R., Biemelt A., Cordshagen A., Johl A., Kuthning D, & Müller-Hilke B. (2016). The Prerequisites for Central Tolerance Induction against Citrullinated Proteins in the Mouse. PLoS ONE, 11(6), e0158773.

+ Open protocol

+ Expand

Quantifying Immune Gene Expression in Spleen

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated from about 30 mg spleen tissue, using RNeasy Mini Kit (Qiagen, Valencia, CA). With the Superscript III First-Strand Synthesis SuperMix (Invitrogen, Grand Island, NY) for RT-PCR, 100 ng total RNA was reverse transcribed and relative quantification of mRNA levels was performed by real-time RT-PCR (SYBR Green; Applied Biosystems, Foster City, CA), using Applied Biosystems 7500 fast real-time PCR system. The following primer sequences were used. Perforin F: 5’-GCATCGGTGCCCAAGCCAGTC-3’, R: 5’-GCCAGCGAGCCCCTGCTCA-3’; Granzyme B F: 5’-CGTGCATCAGAAGTGGTGTTG-3’, R: 5’- GAGGCTGTTGTTACACATCCGG-3’; IFN-γ F: 5’- AGAGCCTCCTCTTGGATATCTGG-3’, R: 5’- GCTTCCTTAGGCTAGATTCTGGTG-3’; TNF-α F: 5’-CCAGGTTCTCTTCAAGGGACAA-3’, R: 5’-CTCCTGGTATGAAATGGCAAA-3’; POMC F: 5’--3’, R: 5’--3’; GAPDH primers were rodent GAPDH control reagents from Applied Biosystems. Measurement of GAPDH RNA levels served as an internal control for all experiments. Amplification was performed for 1 cycle of a sequential incubation at 50 °C for 2 min, 95 °C for 10 min, and subsequent 40 cycles of a consecutive incubation at 94 °C for 15 sec, 60 °C for 30 sec and 72 °C for 35 sec. The individual gene expression value was calculated after normalization to GAPDH.

Zhang C., Franklin T, & Sarkar D.K. (2016). Inhibition of mammary cancer progression in fetal alcohol exposed rats by β-endorphin neurons. Alcoholism, clinical and experimental research, 40(1), 134-140.

+ Open protocol

+ Expand

Gene Expression in Periodontal Tissues

Check if the same lab product or an alternative is used in the 5 most similar protocols

At days 15 and 28, different subsets of rats were sacrificed. For analyses of gene expression, periodontal tissues were harvested and flash-frozen in 1 ml of TRIzol (Life Technologies, Rockville, MA) and stored at −80°C. mRNA levels were determined for COL1A1, TGF-β1, ALP, IL-1α, IL-1β, IL-6, and IL-10. Frozen tissue was homogenized using a tissue-tearor, and total RNA was extracted following the manufacturer’s protocol(Life Technologies, Rockville, MA). From the total RNA, poly (A) tailed RNA were selected using magnetic oligo (dT) beads and a magnetic particle concentrator (Dynal A.S., Oslo, Norway) in accordance to the manufacturer’s protocol. The mRNA was processed to obtain cDNA and stored at −80°C until analysis. Primers and probes for real-time PCR were designed using Primer Express software (Applied Biosystems, Foster City, CA). Real-time (RT-PCR) was performed using PE Biosystems ABI PRISM 7000 sequence detection system. All gene expression was standardized to G3PDH (Rodent GAPDH Control Reagents, Applied Biosystems, Foster City, CA) gene expression in the respective samples.

Gajendrareddy P.K., Junges R., Cygan G., Zhao Y., Marucha P.T, & Engeland C.G. (2016). Increased oxygen exposure alters collagen expression and tissue architecture during ligature-induced periodontitis. Journal of periodontal research, 52(3), 644-649.

+ Open protocol

+ Expand

Quantitative Real-Time PCR and ChIP-qPCR Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

Quantitative Real-Time PCR (qRT-PCR) was performed with an ABI 7500 Real-Time PCR System (Applied Biosystems) in technical duplicates from the indicated number of biological replicates. The qRT-PCR was carried out in a volume of 12 μl using the Absolute qPCR Rox Mix (Thermo Scientific) and the Universal Probe Library (Roche). Primer and probe sets for the detection of single genes are listed in Table S4. GAPDH was detected with Rodent GAPDH Control Reagents (Applied Biosystems). Relative expression values were calculated using the ΔCt method.
qRT-PCR analysis of ChIP samples was performed using SYBR Green Supermix (Biorad) in a final reaction volume of 10 μl and 0.75 μM final primer concentration. Primers are listed in Table S1. HA-tag ChIP signals were calculated as % of the input fraction. The ΔΔCt Method was used to calculate fold enrichment of a genomic locus over the ChIP specific background control (Actb intergenic region for H3K4me3 or gene dessert for Mll1 and Wdr5), both normalized to the signal in the input fraction:

ΔCt [normalized to Input] = (Ct [ChIP] – (Ct [Input] – Log2 (Input Dilution Factor))).

ΔΔCt = ΔCt [region of choice normalized to Input] – ΔCt [control region normalized to Input].

Fold enrichment = 2^(−ΔΔCt).

Schwoerer S., Becker F., Feller C., Baig A.H., Koeber U., Henze H., Kraus J.M., Xin B., Lechel A., Lipka D.B., Varghese C.S., Schmidt M., Rohs R., Aebersold R., Medina K.L., Kestler H.A., Neri F., von Maltzahn J., Tuempel S, & Rudolph K.L. (2016). Epigenetic stress responses induce muscle stem cell aging by Hoxa9 developmental signals. Nature, 540(7633), 428-432.

+ Open protocol

+ Expand

Quantitative RT-PCR for Rat and Mouse IL-6 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was isolated and purified from cultured cells using RNeasy kits (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Before RNA isolation, cells were serum-starved for 24 h. Reverse transcription (RT)-PCR was performed using a one step PrimeScript® RT-PCR Kit (Takara Bio Inc., Shiga, Japan) according to the manufacturer's protocol. The reaction mix contained 40 ng of total RNA, 200 nM primers, 100 nM TaqMan probe, Takara EX Taq® HS and PrimeScript™ RT enzyme Mix. RT-PCR amplification and real-time detection were performed using an Applied Biosystems 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Reverse transcription was performed at 42°C for 5 min followed by inactivation at 95°C for 10 s. The temperature profile consisted of 40 cycles of denaturation at 95°C for 5 s, and annealing/extension at 60°C for 34 s. The sequences of the primers and probe for rat IL-6 were as follows: TaqMan probe, 5′-CAGAATTGCCATTGCACAACTCTTTTCTCA-3′; forward primer, 5′-CAGTGCATCATCGCTGTTCA-3′; and reverse primer, 5′-CATATGTTCTCAGGGAGATCTTGGA-3′. The primers and TaqMan probe for GAPDH were obtained from Rodent GAPDH Control Reagents (Applied Biosystems). Mouse IL-6 expression was estimated using the probe set (Mm0046190-m1) from Applied Biosystems.

Shinozaki Y., Nomura M., Iwatsuki K., Moriyama Y., Gachet C, & Koizumi S. (2014). Microglia trigger astrocyte-mediated neuroprotection via purinergic gliotransmission. Scientific Reports, 4, 4329.

+ Open protocol

+ Expand

Quantitative Real-Time PCR and ChIP-qPCR Protocols

Check if the same lab product or an alternative is used in the 5 most similar protocols

ΔCt [normalized to Input] = (Ct [ChIP] – (Ct [Input] – Log2 (Input Dilution Factor))).

ΔΔCt = ΔCt [region of choice normalized to Input] – ΔCt [control region normalized to Input].

Fold enrichment = 2^(−ΔΔCt).

+ Open protocol

+ Expand

Analyzing Gene Expression in Liver Tissue

Check if the same lab product or an alternative is used in the 5 most similar protocols

Liver specimens were snap-frozen in nitrogen-cooled methylene butane and then stored in liquid nitrogen until RNA analysis. Total RNA was isolated (RNeasy Plus Mini Kit, Qiagen, Germany) and reversely transcribed into cDNA using High-capacity cDNA Reverse Transcriptase Kit (ThermoFisher, Germany) according to the manufacturer’s instructions. Real-time PCR (RT-PCR) was performed in triplicates using the following TaqMan Gene Expression Assays: Foxp3 Mm00475162; Ctla4 Mm00486849; Arg1 Mm00475988; Retnla Mm00445109 (ThermoFisher, Germany). The reaction was performed on the 7900HT Fast Real-Time PCR System under the following reaction conditions: thermal cycling conditions were 50°C for 2 minutes followed by 95°C for 10 minutes, 45 cycles at 95°C for 15 seconds, and at 60°C for 1 minute. Gene expression values were normalized to the endogenous reference gene GAPDH (Rodent GAPDH control reagent, ThermoFisher, Germany) and presented as normalized expression values relative to naive controls.

Koslowski N., Sombetzki M., Loebermann M., Engelmann R., Grabow N., Österreicher C.H., Trauner M., Mueller-Hilke B, & Reisinger E.C. (2017). Single-sex infection with female Schistosoma mansoni cercariae mitigates hepatic fibrosis after secondary infection. PLoS Neglected Tropical Diseases, 11(5), e0005595.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!