The R246Q mutant was inserted by site-directed mutagenesis into the SDR5A2 cDNA using the Quikchange II site-directed mutagenesis kit (Agilent Technologies) as per the manufacture's guidance. In a 50-μL reaction the following components were added: 5 μl of 10× reaction buffer, forward and reverse primers (125 ng), 10 ng of double-strand DNA template, 1 μL of dNTP mix, 3 μL of QuikSolution, and ddH2O to a final volume of 50 μL. Using a thermal cycler (Biometra) samples were incubated at 95°C for 1 minute and then cycled 18 times at 95°C for 50 seconds, 53.4–60°C for 50 seconds, and 68°C for 60 seconds. Samples were then incubated for 68°C for 7 minutes. One microliter DpnI was added to PCR reaction, vortexed, and incubated for 1 hour at 37°C. One mililiter of ethanol (100%) was then added to each tube and incubated for 1 hour at −80°C. The mixture was centrifuged at 16 000 × g for 20 minutes at 4°C and the supernatant aspirated. The DNA pellet was washed with 75% ethanol, centrifuged, aspirated, air dried for 10 minutes, resuspended in 10 μL of RNase-free water. Finally, the DNA vector containing the R246Q mutation was transformed to XL10-Gold ultracompetent cells.
Thermal cycler
Manufactured by Analytik Jena
Sourced in Germany, United States, United Kingdom, China
The Thermal cycler is a laboratory instrument used for the amplification of DNA sequences through the Polymerase Chain Reaction (PCR) process. It precisely controls the temperature, duration, and cycling of the samples to facilitate the DNA replication necessary for various molecular biology techniques.
Automatically generated - may contain errors
Lab products found in correlation
Mytaq red dna polymerase master mix, by Meridian Bioscience (3 mentions)
Digital gel documentation system, by Bio-Rad (3 mentions)
Taq dna polymerase, by Takara Bio (2 mentions)
Pcr master mix 1, by Promega (2 mentions)
Pgem t easy vector, by Promega (2 mentions)
Trizol reagent, by Thermo Fisher Scientific (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Quikchange 2 site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Dna marker 2, by A&A Biotechnology (1 mentions)
Genomic micro ax staphylococcus gravity, by A&A Biotechnology (1 mentions)
Midori green dna stain, by Nippon Genetics (1 mentions)
Transzol solution, by Transgene (1 mentions)
Nanodrop n 100, by Thermo Fisher Scientific (1 mentions)
M mlv enzyme, by Promega (1 mentions)
Titanium taq dna polymerase, by BD (1 mentions)
Mgcl2, by Promega (1 mentions)
Reverse transcriptase, by Thermo Fisher Scientific (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Emeraldamp max pcr master mix, by Takara Bio (1 mentions)
Dna extraction kit, by Takara Bio (1 mentions)
56 protocols using thermal cycler
1
Site-Directed Mutagenesis of SDR5A2 Gene
2
Staphylococcus Antimicrobial Resistance Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA was isolated from the tested isolates within the study by means of Genomic Micro AX Staphylococcus Gravity (A&A Biotechnology, Poland) commercial set according to the manufacturer’s protocol. PCR was conducted with primers synthesized by the Genomed Sequencing Laboratory, Poland, specific for the mecA [29 (link)], erm(A), erm(B), erm(C), lnu(A), msr(A), msr(B) [23 (link)], mph(C) [30 (link)], ere(A) and ere(B) [31 (link)] genes. DNA amplification was performed in the thermal cycler (Biometra, Germany). The reaction products were detected by electrophoresis (70 V, 1.5 h) in 1% (w/v) agarose gels containing Midori Green DNA stain (NIPPON Genetics EUROPE, Germany). A CCD camera (Syngen, Poland) was used in order to obtain results. The sizes of the amplification products were determined by the usage of a commercial molecular size marker DraMix or DNA Marker 2 (A&A BIOTECHNOLOGY, Poland). The presence of tested of genes was determined on the basis of the sizes of the amplification products with specific primer. S. epidermidis ATCC51625 harboring the mecA gene and 3 S. epidermidis strains: S. epidermidis 3718INL harboring erm(B) and mph(C) genes, S. epidermidis 1486IG harboring erm(A), erm(C) and mph(C) genes as well as S. epidermidis 1923KIINL harboring the msr and lnu(A) genes were used as positive controls [32 (link)].
3
Fungal DNA Extraction and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total genomic DNA was isolated from fruit bodies according to [19 ]. The total isolated DNA were column purified using DNA Purification MiniSpin Kit (VIOGENE cat# PF1001) according to the manufacturer’s protocol. The purified DNA was used as a template for PCR reaction using Mytaq Red DNA polymerase master mix (BIOLINE cat # BIO-21108) according to manufacture instructions. Briefly, the reaction was containing 1× PCR red master mix buffer, 2.0 μl of 10 pm/μl of each primer; ITS1 (5′ TCCGTAGGTGAACCTGCGG 3′) and ITS4 (5′ TCCTCCGCTTATTGATATGC 3′), 1.0 μl of DNA template (~ 30 ng), 0.25 μl of MyTaq™ DNA polymerase (5 U/μl), then the total volume was adjusted to 50 μl using sterile water. The amplification reactions were performed in Thermal Cycler (Biometra, Germany) as follow: 1st cycle of 3 min at 95 °C for initial denaturation, followed by 35 cycles of 20 s at 95 °C (denaturation), 20 s at 55 °C (annealing), 30 s at 72 °C (extension), and then a final extension was carried out for 10 min at 72 °C; the reaction was held at 4 °C. The PCR products were separated on 1% agarose gel, the amplified fragments were purified using a PCR-M clean-up system (VIOGENE cat# PF1001) according to the manufacturer’s protocol, followed by sequencing with ITS1 primer at GATC Company using ABI 3730xl DNA-sequencer.
4
PCR Amplification of Bacterial phlD Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Bacterial DNA was used for PCR amplification with specific phlD gene primers (Phl2a and Phl2b) designed by Raaijmakers et al. (1997 (link)). PhlD gene amplification was performed in 25 µl reaction mixture containing 1 µM of each primer, 0.2 µM of DNA template each dNTP, 4 mM MgCl2, 1U Tag Hot Start polymerase (Promega) and 1 µl of DNA template. This reaction mixture was incubated in a thermal cycler (Biometra) with initial denaturation (96 °C for 2 min) and then cycled 35 times through the following temperature profile: denaturation at 96 °C for 15 s, annealing at 60 °C for 15 s, extension at 72 °C for 1 min, and the single final extension at 72 °C for 5 min. A 2-µl aliquot of the amplified PCR product was separated by gel electrophoresis in 1 % agarose with ethidium bromide in TBE buffer for 30 min and was visualized with a UV transilluminator. The 720-bp PCR product was sequenced by Genomed. The phylogenetic tree was inferred by the neighbour-joining method using MEGA v 6.0.
5
Amplification of Minicircle Kinetoplast DNA
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The Forward and Reverse primers set, 121 (5’-AAATAATGTACGGGKGAGATGCATGA-3’) and 122 (5’-GGTTCGATTGGGGTTGGTGTAATATA-3’) were used for amplification of minicircle kinetoplast DNA[29 (link)], to obtain 330 bp amplicon. Each sample was tested in a final volume of 25 μl including 1 μl (10–15 ng) of extracted DNA, 0.5μl (10 pmol/μl) of the primers (121,122), and 2.5 μl of 10× buffer containing 25 mM MgCl2, 2.5 mM of dNTPs, and 2 unit of Takara Ex Taq enzyme (Takara Bio. Inc., Shiga, Japan). The PCR amplification was performed using Thermal cycler (Biometra, GmbH, Germany) programmed at 94 °C for 3 minutes as initial denaturation, followed by 2 cycles at 97.5°C for 1 minute and 64°C for 2 minutes, 33 cycles at 94°C for 1 minutes and 62°C for 1 minute, and a final extension for 10 minutes at 72 °C. The product from PCR was confirmed by 2% agarose gel electrophoresis [29 (link)].
6
Bursal Tissue Total RNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from bursal tissue was isolated using TransZol solution (TransGen Biotech, Beijing, China) according to the manufacturer's guidelines. RNA concentration and purity were measured using a Nanodrop N100 (Thermo ScientificTM, Wilmington, USA) and agarose gel electrophoresis. One μg of RNA sample was reverse transcribed into cDNA using the MMLV enzyme (Promega, USA) in a 20 μL reaction mixture. A cDNA synthesis reaction was performed in a thermal cycler (Biometra, USA) according to the manufacturer's guidelines.
7
Thermal Lysis-Based DNA Extraction
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA was extracted using a thermal lysis technique (Ahmed et al. 2013 ). In brief, 3–5 bacterial colonies were added to 200 µL of distilled water in a PCR tube. The PCR tube was then heated at 98 °C for 20 min using a thermal cycler (Biometra, Göttingen, Germany). Afterward, cellular debris was pelletized by centrifuging the tubes for 5 min at 14.000 rpm. We subsequently transferred the supernatant into sterile, labeled Eppendorf tubes and stored them at -20 °C for further processing.
8
HPV 16 and 18 Genotyping by PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Consensus primers were used to amplify the HPV16 and HPV18, i.e., MY09/11 and GP05/06. Primer sequence for MY09/11 was MY09—5′-CGTCCMARRGGAWACTGATC-3′ and MY11—5′-GCMCAGGGWCTATAAYAATGG-3′ and product size was 450 bp for HPV 16, while primer sequence for GP05/06 was GP-05—5′-TTTGTTACTGTGGTAGATACYAC-3′ and GP-06—5′-GAAAAATAAACTGTAAATCATATTC-3′ and product size was 140 bp for HPV 18. PCR was conducted in Biometra Thermal Cycler. Reaction mixture contains micromole of oligonucleotide, 2× PCR buffer, 100 ng of DNA template, and nuclease-free water. Hot start PCR program for both primers are initial denaturation at 95 °C for 5 min, denaturation at 94 °C for 45 s, annealing at 47.5 °C for 45 s, extension at 72 °C for 45 s followed by 40 cycles, and final extension at 72 °C for 7 min. Agarose gel electrophoresis was carried out to check the PCR amplification.
9
Multilocus Sequencing for Bacterial Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Partial sequences of six protein-coding genes (leuS, rpoB, gyrB, fusA, pyrG, and rplB) were generated for all the reference/type strains not available in public databases. The primer pairs and conditions applied in this study are as described by Delétoile et al.1 (link) with the exception of rpoB. rpoBjt112 (GTTTATGGAYCAGAACAACCC)/rpoBjt748 (ATACGTGATGCRTCAACGTACT) primer pair was designed for rpoB and used in this study with an initial denaturation of 95 °C for 3 minutes, followed by 40 cycles of 95 °C for 45 seconds, 65 °C for 45 seconds, 72 °C for 90 seconds, and a final extension at 72 °C for 10 minutes. Primers were synthesized by Invitrogen Inc. (Carlsbad, CA, USA), and PCR amplifications were performed in a thermal cycler (Biometra) using 10 ng of bacterial DNA (1 μL), 1 μL of 10× PCR buffer, 0.75 μL of 2 mM deoxynucleoside triphosphates (dNTPs), 0.08 μL of each primer (20 μM), 0.1 μL of Titanium Taq DNA polymerase (5 U/μL; BD/Biosciences/Clontech), and 6.99 mL of MilliQ water. Sequencing was done as previously described10 (link) using ABI BigDye Terminator chemistry v3.1 (Applied Biosystems) and run on an ABI 3130xl automated sequencer (Applied Biosytems/Hitachi). Sequences were edited using SeqMan (DNASTAR).
10
Amplification of Alpha Amylase Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Alpha amylase gene was amplified by polymerase chain reaction (PCR) method as described by Zidani et al. [49] using the specific forward and reverse primers (AmyFP 5′-CATCTGGATCACCCCCGTTA-3′ and AmyRP 5′-AGACTTACGAAGCGAACCGT-3′, respectively) and the isolated fungal genomic DNA as template. The PCR mixture (25 µl) contained, 1.25 µl each of forward and reverse primers (5 mM each), 1.25 µl of 2.5 mM dNTP mix (dATP, dGTP, dTTP, dCTP) (Promega), 10 × NH4 buffer (1.25 µl), 1.0 µl of 50 mM MgCl2 (Promega), 1.0 µl of 5 unit/µl of Taq DNA polymerase, 7.25 µl of dd·H2O and 7.25 µl of 10 ng/µl of genomic DNA. The PCR program was performed on a thermal cycler (Biometra) system as follow: Stage 1 (x1): 94 °C for 5 min to achieve the initial DNA denaturation; Stage 2 (x 35): 94 °C for 30 s, for denaturation; 60 °C for 30 s, for annealing; and 72 °C for 5 min, for extension. Stage 3 (x1): 72 °C for 5 min and 10 °C for infinity (∞). The presence of amplified α-amylase genes was established by agarose gel electrophoresis using 1.0% agarose stained with 3 µl of ethidium bromide (5 µg/µl) and viewed with Enduro Gel Doc machine.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!