Cultured human adult exocrine tissue and E14.5 mouse fetal pancreatic epithelia were extracted in RIPA extraction buffer (0.05M Tris-HCl, pH 7.4, 0.15M NaCl, 0.25% deoxycholic acid, 1% NP-40, 1mM EDTA) supplemented with HALT protease and phosphatase inhibitor (Thermo Scientific, Waltham, MA, USA). Approximately 0.5 mg of human tissue protein lysate and lysate-free negative control were incubated overnight with 5 μg anti-mouse NGN3 F25A1B3 (concentrate) at 4°C. Bound proteins were isolated with magnetic beads covalently bound to Protein G (DYNAL, Carlsbad, CA, USA). Immunoprecipitated proteins and ~20μg E14.5 mouse pancreatic lysate were resolved on 12% HEPES/glycine/SDS gels and transferred to Immobilon-Fl PVDF membrane (Millipore, Billerica, MA, USA) and detected with F25A1B3 then reprobed with anti-E12/47. For coprecipitation of HES1 and ID proteins, approximately 0.5 mg of human tissue protein lysate was incubated overnight with 5 μg anti-HES1 (Cell Signaling, Beverly, MA, USA) at 4°C then immunoprecipitated and western blotted as above. Western blot strips were incubated in anti-ID1, ID2 and ID4 antibodies (Santa Cruz Biotechnology, Santa Cruz, CA, USA). Other antibodies used for protein detection were anti-V5 epitope (Sigma), anti-cleaved Notch 1 (Cell Signaling, Beverly, MA, USA) and anti-GAPDH (Millipore, Billerica, MA, USA).
Anti hes1
Manufactured by Cell Signaling Technology
Sourced in United States
Anti-HES1 is a primary antibody that recognizes the HES1 protein. HES1 is a transcriptional repressor that plays a role in various cellular processes, including cell differentiation and embryonic development.
Automatically generated - may contain errors
Lab products found in correlation
Anti notch1, by Cell Signaling Technology (9 mentions)
Anti cleaved notch1, by Cell Signaling Technology (5 mentions)
Anti nicd, by Cell Signaling Technology (4 mentions)
Anti gapdh, by Cell Signaling Technology (4 mentions)
Anti e cadherin, by Cell Signaling Technology (3 mentions)
Horseradish peroxidase conjugated secondary antibody, by Jackson ImmunoResearch (2 mentions)
Polyvinylidene difluoride membrane, by Merck Group (2 mentions)
Anti nicd, by Abcam (2 mentions)
Anti notch1, by Abcam (2 mentions)
Anti oct4, by Cell Signaling Technology (2 mentions)
Anti yap, by Cell Signaling Technology (2 mentions)
Anti bcl 2, by Cell Signaling Technology (2 mentions)
Anti n cadherin, by Cell Signaling Technology (2 mentions)
Anti hey1, by Abcam (2 mentions)
Anti vimentin, by Cell Signaling Technology (2 mentions)
Pierce bca protein assay kit, by Thermo Fisher Scientific (2 mentions)
Anti gapdh, by Merck Group (1 mentions)
Immobilon fl pvdf membrane, by Merck Group (1 mentions)
Halt protease and phosphatase inhibitor, by Thermo Fisher Scientific (1 mentions)
Anti erk, by Cell Signaling Technology (1 mentions)
26 protocols using anti hes1
1
NGN3 Protein Complexes in Human Exocrine Tissue
2
Western Blot Analysis of Notch Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Western blotting was performed as described previously (17 (link)). The primary antibodies and their sources were as follows: anti-Notch1, anti-Hes1, anti-NICD, anti-pERK, anti-ERK, and anti-pAKT (Cell Signaling Technology, Beverly, MA, USA); anti-Jagged1, anti-β-actin, anti-AKT, and anti-DUSP1 (Santa Cruz Biotechnology); anti-HBx (Merck-Millipore); anti-PTEN (Proteintech Group, Chicago, IL, USA). Horseradish peroxidase-conjugated secondary antibodies were purchased from Jackson Immuno Research Laboratories (West Grove, PA, USA).
3
Melanoma Tumor Marker Expression Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Anti-S100 (melanoma tumor marker) (Roche Ventana #790-2914), anti-Ki67 (proliferation marker) (Abcam #ab16667), anti-NOTCH1 (Millipore Sigma 07-1231), anti-NICD (Cell signaling #4147), anti-HES1 (Cell signaling #11988), anti-MAP2 (ThermoFisherSci #PA5-24589, Waltham, MA, USA) and anti-NOTCH2 (Sigma #HPA048743) antibodies were utilized.
4
Western Blot Analysis of Notch Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Anti-Actin (catalog number [Cat#] sc-47778, 1:2,000), anti-p130 (Cat# sc-374521, 1:3,000), anti-p21 (Cat# sc-53870, 1:3,000), anti-p130 (Cat# sc-374521, 1:3,000), and anti-PML (Cat# sc-377390, 1:3,000) were purchased from Santa Cruz Biotechnology. Anti-TAp73 (Cat# A300-126A, 1:1,000) was purchased from Bethyl Laboratories, Inc. Anti-HA (Cat# 901513, 1:2,000) was purchased from BioLegend. Anti-Cleaved Notch1 (Cat# 4741, 1:1,000), anti-Notch1 (Cat# 4380T, 1:1,000), and anti-Hes1 (Cat# 11988S, 1:800) were purchased from Cell Signaling Technology. WesternBright ECL HRP substrate (Cat# K-12043-D20) was purchased from Advansta. Scrambled siRNA (5′-GGC CGA UUG UCA AAU AAU U-3′), sip73α1 siRNA (5′-ACC UGG GGC CCG UGG UUU-3′), siE11 siRNA#1 (5′-GCA CAG UUC GGC AGC UAC A-3′), siE11 siRNA#2 (5′-UCC UCU CGC CCA UGA ACA A-3′), and siNotch1 siRNA (5′-ACA AAG AUA UGC AGA ACA A-3′) were purchased from Horizon Discovery Biosciences Limited. RNAiMax (Cat# 13778150, Invitrogen), Protease Inhibitor Mixture (Cat# 78438), Magnetic Protein A/G beads (Cat# 78609), RevertAid RT Reverse Transcription Kit (Cat# K1691), and DreamTaq DNA Polymerase (Cat# EP0702) were all purchased from ThermoFisher. All reagents were used according to the manufacturer’s protocol.
5
Immunoprecipitation and Western Blot Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cells were lysed in buffer containing 150 mM NaCl, 1% Triton-X 100, 0.5% sodium deoxycholate, 1 M Tris-HCl, pH 7.5 and 1% phenylmethylsulfonyl fluoride (Solarbio) on ice for 30 min. For immunoprecipitation (IP) analysis, lysates were incubated with agarose beads (GE Healthcare) and different antibodies as specified in the figures. Immunocomplexes were washed with washing buffer (150 mM NaCl, 1% Triton-X 100, 0.5% sodium deoxycholate, 1 M Tris-HCl, pH 7.5) and then eluted from the beads with elution buffer (150 mM NaCl, 1% Triton-X 100, 0.5% sodium deoxycholate, 0.1% SDS, 1 M Tris-HCl, pH 7.5). All samples were detected by western blotting. For western blotting analysis, lysates were centrifuged at 15,616× g for 10 min at 4°C, and protein concentration in the supernatant was determined by Super-Bradford Protein Assay Kit (CWBIO) and normalized. After electrophoretic separation by SDS-PAGE, proteins were transferred to polyvinylidene difluoride membranes (Millipore). All blots were performed as described previously (Huang et al., 2007 (link)) with indicated antibody and visualized using Immobilon Western Chemiluminescent HRP Substrate (Millipore). Antibodies were obtained from the following sources: anti-His, anti-Flag and anti-HA, Sigma; anti-neuritin, anti- NEURL1 and anti-NICD, Abcam; anti-HES1, Cell Signaling Technologies; anti- actin, ZSGB-BIO.
6
Immunofluorescence Assay for Neural Markers
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following primary antibodies were used: anti-NOTCH1 (1:500, rabbit IgG, 3608, Cell Signaling Technology, Danvers, MA, USA), anti-HES1 (1:200, rabbit IgG, 11988, Cell Signaling Technology), anti-RBPJ (1:1000, rabbit IgG, 5313, Cell Signaling Technology), anti-JAG1 (1:200, rabbit IgG, ab109536, Abcam, Cambridge, UK), anti-DLL1 (1:100, mouse IgG2b, MAB18181, R&D, Minneapolis, MN, USA), anti-POU4F3 (1:200, mouse IgG1, sc-81980, Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-ATOH1 (1:500, rabbit IgG, 21215-1, Proteintech, Rosemont, IL, USA), anti-SOX2 (1:200, goat IgG, AF2018, R&D), anti-MYOSIN7A (1:30, mouse IgG1, 138-1-s, DSHB, Iowa City, IA, USA), anti-MYOSIN7A (1:100, rabbit IgG, 25-6790, Proteus Biosciences, Ramona, CA, USA), anti-CDKN1B (1:200, mouse IgG1, 610242, BD, Franklin Lakes, NJ, USA). The following secondary antibodies were used: donkey anti-rabbit IgG, Alexa Fluor Plus 555 (1:500, A32794, Invitrogen), donkey anti-mouse IgG, Alexa Fluor Plus 488 (1:500, A32766, Invitrogen), and donkey anti-goat IgG, Alexa Fluor 647 (1:500, 705-605-147, Jackson Immuno-Research).
7
Comprehensive Protein Analysis Techniques
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Western blot, immunofluorescence (IF),51 (link) and immunohistochemistry (IHC)52 (link) were performed as previously described. Anti-Notch1, anti-β-catenin, anti-p84, anti-APC, anti-GSK3β, anti-CK1α, and anti-β-TrCP antibodies were purchased from Abcam. Anti-Nanog, anti-BMI1, anti-Oct4, and anti-HES1 antibodies were obtained from Cell Signaling Technologies. Anti-TET3 and anti-actin antibodies were purchased from GeneTex and Sigma, respectively. Western band intensity was quantified using ImageJ software (NIH).
8
Immunoblotting Antibody Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immunoblotting was performed using sodium dodecyl sulphate-polyacrylamide gel electrophoresis gels using the following antibodies: anti-β-actin (Sigma, A5441, 1:10,000); anti-HRAS (Calbiochem, OP-23, 1:500); anti-NOTCH1 (Cell Signaling, 4380, 1:500); anti-HES1 (Cell Signalling, 11988, 1:1000); anti-FLAG (Cell Signaling, 2368, 1:1000), anti-HMGA1 (Cold Spring Harbor Labs, #37, 1:1000); anti-HMGA1 (Abcam, Ab4078, 1:1000); anti-HMGA2 (Cold Spring Harbor Labs, #24, 1:1000); anti-GFP (Clontech 632377, 1:1000); and anti-JAG1 (Cell Signaling, 2155, 1:1000). Images of uncropped immunoblots are included in Supplementary Fig. 11 .
9
Investigating O-GlcNAc Regulation in Cell Signaling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The following primer sequences were used: OGT forward: CAGCATCCCAGCTCACTT, reverse: CAGCTTCACAGCTATGTCTTC; HES1 forward: ACGTGCGAGGGCGTTAATAC, reverse: GGGGTAGGTCATGGCATTGA; OGA forward: CGAGTGAACATTCCCATCACT, reverse: CCCAAAGGAGCACAGATGTT; PTEN forward: CGAACTGGTGTAATGATATGT, reverse: CATGAACTTGTCTTCCCGT.
The following antibodies from Cell Signaling Technology (Danvers, MA) were used: anti-OGT (#5368), anti-HES1 (#11988), anti-phospho-Ser235/236-S6 (#4858), anti-γ-H2AX (#9718), anti-PARP (#9542), and anti-Histone 3 (#4499). Mouse-derived anti-O-Linked N-Acetylglucosamine (RL2) (ab2739) was acquired from Abcam (Cambridge, UK). Mouse anti-α-tubulin (#CP06) was from Merck Millipore (Burlington, MA).
The following chemical compounds were used: OSMI1 compound was kindly provided by Professor Suzanne Walker (Harvard Medical School). Additional OSMI1 compound was purchased from Sigma Aldrich (SML1621). Efficacy of the two OSMI1 stocks was determined to be similar (data not shown); O-GlcNAcase inhibitor PUGNAc (A7229), MG132 proteasome inhibitor (M7449), mTORC1 inhibitor Everolimus (Ev) (SML2282) and PR inhibitor mifepristone (MF) (M8046), were purchased from Sigma Aldrich. γ-secretase inhibitor (GSI) RO4929097 was purchased from Selleckchem (S1575).
The following antibodies from Cell Signaling Technology (Danvers, MA) were used: anti-OGT (#5368), anti-HES1 (#11988), anti-phospho-Ser235/236-S6 (#4858), anti-γ-H2AX (#9718), anti-PARP (#9542), and anti-Histone 3 (#4499). Mouse-derived anti-O-Linked N-Acetylglucosamine (RL2) (ab2739) was acquired from Abcam (Cambridge, UK). Mouse anti-α-tubulin (#CP06) was from Merck Millipore (Burlington, MA).
The following chemical compounds were used: OSMI1 compound was kindly provided by Professor Suzanne Walker (Harvard Medical School). Additional OSMI1 compound was purchased from Sigma Aldrich (SML1621). Efficacy of the two OSMI1 stocks was determined to be similar (data not shown); O-GlcNAcase inhibitor PUGNAc (A7229), MG132 proteasome inhibitor (M7449), mTORC1 inhibitor Everolimus (Ev) (SML2282) and PR inhibitor mifepristone (MF) (M8046), were purchased from Sigma Aldrich. γ-secretase inhibitor (GSI) RO4929097 was purchased from Selleckchem (S1575).
10
Protein Fractionation and Western Blotting
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Proteins were fractionated by sodium dodecyl sulfate polyacrylamide gel electrophoresis, transferred to polyvinylidene difuoride (PVDF) membranes (Millipore,Shanghai, China),. PVDF membranes were blocked with 5% nonfat milk at room temperature for 2 h, and incubated with antibodies at 4 °C overnight,as described previously [42 (link)]. Primary antibodies were used as follows: anti-CDK4 (1:1000, Bioward Technology, Nanjing, China), anti-CDK5 (1:1000, Boster, Wuhan, China), anti-CDK6 (1:500, Bioward Technology), anti-cyclin D1 (1:500, Bioward Technology), anti-p27 (1:1000, Bioward Technology), anti-Notch1 (1:1000, Cell Signaling Technology, Boston, MA, USA), anti-NICD (1:1000, Abcam, Cambridge, MA, USA), anti- RBP-Jĸ (1:1000, Abcam), anti-Hes1 (1:1000, Cell Signaling Technology), and anti-β-actin (1:1000, ZSGB-BIO, Beijing, China). The secondary antibody was goat anti-mouse IgG (1:10,000, ZSGB-BIO) or goat anti-rabbit IgG (1:10,000, ZSGB-BIO), and enhanced chemiluminescence (ECL) detection (Millipore, Temecula, CA, USA). The exposure was performed using the Flour Chem HD2 imaging analyzer from ProteinSimple company.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!