Lipofectamine ltx with plus reagent

Manufactured by Thermo Fisher Scientific

Sourced in United States, United Kingdom

Lipofectamine LTX with Plus Reagent is a transfection reagent designed to facilitate the delivery of DNA, RNA, or other macromolecules into a variety of mammalian cell types. It is a lipid-based formulation that forms complexes with the nucleic acids, enabling their efficient uptake by the target cells.

Automatically generated - may contain errors

Lab products found in correlation

206 protocols using lipofectamine ltx with plus reagent

TFCP2 Lentiviral Transduction and Knockdown

Check if the same lab product or an alternative is used in the 5 most similar protocols

Lentiviral particles carrying the human TFCP2 gene were produced by co-transfection of HEK293T cells with a psPAX2 packaging plasmid (Addgene plasmid #12260), the VSV-G-encoding plasmid pMD2.g (Addgene plasmid #12259), and a human TFCP2 lentiviral vector (pLenti-GIII-CMV-TFCP2-HA, Applied Biological Materials). Medium containing the lentivirus particles was collected and used to infect A375 TFCP2 mutant cells. After infection, the cells were cultured with 2 μg/ml puromycin to select for stably transduced cells.
For A375 rescue experiments, TFCP2^C21 cells (2 × 10⁵ cells/well) were transfected with Lipofectamine LTX with Plus reagent (Invitrogen) and a human HS6ST2-HA expression plasmid (Applied Biological Materials Inc), a human GPC4-HA expression plasmid (Sino Biological), or an siRNA targeting human SULF1 (SASI_Hs02_00330796, Sigma). For knockdown experiments, cells (2 × 10⁵ cells per well) were transfected with Lipofectamine LTX with Plus reagent (Invitrogen) and a siRNA targeting human TFCP2 (SASI_Hs01_00128372; Sigma) according to the manufacturer’s instructions. Cells were incubated with this mixture for 4 h, after which the medium was replaced with DMEM or MEM (+ 10% FBS). FACS binding and qPCR experiments were performed 48 h post-transfection.

Basu A., Champagne R.N., Patel N.G., Nicholson E.D, & Weiss R.J. (2023). TFCP2 is a transcriptional regulator of heparan sulfate assembly and melanoma cell growth. The Journal of Biological Chemistry, 299(6), 104713.

+ Open protocol

+ Expand

Transfection of Macrophages and HEK293 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

RAW264.7 macrophages were transfected with constitutively active Cdc42 plasmid (pcDNA3-EGFP-Cdc42(Q61L), Addgene plasmid # 12600) [35 (link)]. Briefly, cells were seeded in antibiotic-free RPMI-1640 media supplemented with 10% FBS. Transfections were performed 18 h later when cells were 70–80% confluent. Transfections were done using Lipofectamine LTX with Plus Reagent (Invitrogen) according to manufacturer’s protocol.
HEK293 cells were transfected either with HIV-1 Nef_SF2WT (kind gift of Dr Matija Peterlin) or control pEGFP- C1 plasmid (Clontech) using Lipofectamine LTX with Plus Reagent (Invitrogen) according to manufacturer’s protocol. Average transfection efficiency was 80%.

Mukhamedova N., Hoang A., Dragoljevic D., Dubrovsky L., Pushkarsky T., Low H., Ditiatkovski M., Fu Y., Ohkawa R., Meikle P.J., Horvath A., Brichacek B., Miller Y.I., Murphy A., Bukrinsky M, & Sviridov D. (2019). Exosomes containing HIV protein Nef reorganize lipid rafts potentiating inflammatory response in bystander cells. PLoS Pathogens, 15(7), e1007907.

+ Open protocol

+ Expand

Oleate-Induced Lipid Droplet Formation in AML12 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

AML12 cells (CRL-2254, American Type Culture Collection (ATCC)) were cultured in DMEM/Ham’s F12 medium supplemented with 10% FBS (5 μg ml⁻¹ insulin, 5 μg ml⁻¹ transferrin, 5 μg ml⁻¹ selenium, 40 ng ml⁻¹ dexamethasone, 100 U ml⁻¹ penicillin and 100 μg ml⁻¹ streptomycin). Oleate-containing medium was prepared by the addition of BSA-conjugated oleic acid (no. SIAL-O3008, Sigma) to culture medium. Control cell culture medium contained the same levels of fatty acid-free BSA (no. A8806, Sigma). To generate eIF4E^+/− AML12 cell lines, single-guide RNA (ATTAaGGAAACCACCCCTACC) targeting eIF4E was cloned into plasmid PX458 containing Cas9-green fluorescent protein (GFP). AML12 cells were transfected with the plasmid using Lipofectamine LTX with Plus Reagent (no. A12621, ThermoFisher) and selected by GFP using Sorter. Single cells were then plated and grown to create single-cell clones. eIF4E^+/− cell lines were picked based on eIF4E expression levels by immunoblotting and sequencing on sgRNA target regions. Primers used for sequencing were: forward, GAGTAGCCCGATTCTCCTAGAGAG; reverse, CTACAGGCTGACAACTGATCACATC. AML12 cells were transfected with plasmid containing Plin2 cDNA tagged with Flag (no. NM_007408, ORIGENE) using Lipofectamine LTX with Plus Reagent (no. A12621, ThermoFisher).

Grossman Z, & Paul W.E. (1992). Adaptive cellular interactions in the immune system: the tunable activation threshold and the significance of subthreshold responses.. Proceedings of the National Academy of Sciences of the United States of America, 89(21), 10365-10369.

+ Open protocol

+ Expand

Stable Transfection of SW756 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

SW756 cells were stably transfected with 2 μg of pUNO1-hOSM expression construct (InvivoGen, Toulouse, France), using Lipofectamine LTX with PLUS reagent (Thermo Fisher Scientific, Loughborough, UK) followed by Blasticidin (InvivoGen) selection at 5 μg ml⁻¹. Control transfections were performed simultaneously using 2 μg of empty vector. For in vivo experiments, bioluminescent SW756 cells were generated by stable transfection of pGL4.51 luciferase reporter vector (Promega, Southampton, UK), using Lipofectamine LTX with PLUS reagent followed by G418 (Thermo Fisher Scientific) selection at 1.2 mg ml⁻¹.

Kucia-Tran J.A., Tulkki V., Smith S., Scarpini C.G., Hughes K., Araujo A.M., Yan K.Y., Botthof J., Pérez-Gómez E., Quintanilla M., Cuschieri K., Caffarel M.M, & Coleman N. (2016). Overexpression of the oncostatin-M receptor in cervical squamous cell carcinoma is associated with epithelial–mesenchymal transition and poor overall survival. British Journal of Cancer, 115(2), 212-222.

+ Open protocol

+ Expand

Silencing and Overexpressing Epigenetic Regulators in BMMSCs

Check if the same lab product or an alternative is used in the 5 most similar protocols

For siRNA knockdown, we seeded 0.2 × 10⁶ BMMSCs on a 6-well culture plate. Tet1, Tet2, and P2rX7 siRNAs (Santa Cruz Biotechnology) were used to treat the BMMSCs according to the manufacturer’s instructions. Non-targeting control siRNAs (Santa Cruz Biotechnology) were used as negative controls. pCDF-mTET1 (Addgene #81052), pCDF-His-mTET1CD∆cat (Addgene #81054), pcDNA3-Tet2 (Addgene #60939), and pScalps_Puro_mTet2 catalytic domain HxD (Addgene #79611) were purchased from Addgene (Cambridge, MA). For P2rX7 CRISPR activation and Tet plasmid (Santa Cruz Biotechnology) transfection, we seeded 0.2 × 10⁶ BMMSCs on a 6-well culture plate, and transfected with P2rX7 CRISPR activation plasmid (Santa Cruz Biotechnology) using Lipofectamine LTX with Plus reagent (Life Technologies) according to the manufacturer’s instructions. We used control CRISPR activation plasmids as a negative control. The miR-297a-5p, miR-297b-5p, and miR-297c-5p mimics, inhibitors and negative controls (Qiagen) were transfected into cells according to the manufacturer’s instructions. Briefly, BMMSCs (0.2 × 10⁶) were seeded on a 6-well culture plate and transfected with miR-297a-5p, miR-297b-5p, miR-297c-5p mimics, or inhibitors using Lipofectamine LTX with Plus reagent (Life Technologies) according to the manufacturer’s instructions.

Yang R., Yu T., Kou X., Gao X., Chen C., Liu D., Zhou Y, & Shi S. (2018). Tet1 and Tet2 maintain mesenchymal stem cell homeostasis via demethylation of the P2rX7 promoter. Nature Communications, 9, 2143.

+ Open protocol

+ Expand

Silencing and Overexpression of MCPyV Targets

Check if the same lab product or an alternative is used in the 5 most similar protocols

For silencing of MCPyV T‐antigens or miRNAs, 2 μg of shRNA or miRNA sponge plasmid DNA was transfected into 3 × 10⁶ WaGa and MKL‐1 cells using Nucleofector kit V (program D‐24 and A‐24, respectively; Lonza, Basel, Switzerland). For overexpression of MCPyV T‐antigen(s) or miRNAs, 2 μg of T‐antigen or miRNA expression plasmid DNA was transfected into 3 × 10⁵ cells of MCC13, MCC14/2 and MCC26 cell lines using Lipofectamine LTX with plus reagent (Invitrogen, Carlsbad, CA). For transfection of miR‐375 mimics (MC10327; Ambion) or miRNA mimic negative control (NC, AM17110; Ambion), 10 nM of miRNA mimic was transfected into cells using Lipofectamine RNAiMAX Reagent (Invitrogen).
For inhibition of autophagy flux, 40 nM bafilomycin A1 (B1793; Sigma‐Aldrich) was added in the growth medium and incubated for 2 hr prior to analysis. Cells treated with dimethyl sulfoxide (DMSO) alone (1:1,000 dilution; Sigma‐Aldrich, St. Louis, MO) were used as a control. For inhibition of transcription, 2.5 μg/μl actinomycin D (A1410; Sigma‐Aldrich) was added in the growth medium for 0, 6 and 24 hr.

Kumar S., Xie H., Shi H., Gao J., Juhlin C.C., Björnhagen V., Höög A., Lee L., Larsson C, & Lui W. (2019). Merkel cell polyomavirus oncoproteins induce microRNAs that suppress multiple autophagy genes. International Journal of Cancer, 146(6), 1652-1666.

+ Open protocol

+ Expand

Inhibitors for Cellular Signaling Pathways

Check if the same lab product or an alternative is used in the 5 most similar protocols

Proteasome inhibitor MG132 was purchased from Peptides International (Louisville, KY, USA). Gamma-secretase inhibitors compound E and L685, 458 and proteasome inhibitor lactacystin were purchased from EMD Millipore (Billerica, MA, USA). Lysosome inhibitors chloroquine, leupeptin, and NH₄Cl were purchased from Sigma (St. Louis, MO, USA). The general caspase inhibitor, benzyloxycarbonyl-Val- Ala-Asp-fluoromethylketone (Z-VAD-fmk) was purchased from Enzo Life Sciences (Farmingdale, NY, USA). Complete protease inhibitor cocktail tablets were purchased from Roche Applied Science (Indianapolis, IN, USA). Lipofectamine LTX with plus reagent was purchased from Invitrogen (Carlsbad, CA, USA).

Hu C., Zeng L., Li T., Meyer M.A., Cui M.Z, & Xu X. (2016). Nicastrin is required for APP but not Notch processing, while Aph-1 is dispensable for processing of both APP and Notch. Journal of neurochemistry, 136(6), 1246-1258.

+ Open protocol

+ Expand

Transfection of HEK293 and HeLa Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

HEK293 or HeLa cells were grown at 37 °C and 5% CO₂ in DMEM supplemented with 10% fetal calf serum and antibiotics (penicillin-streptomycin). Mature murine ODC cultures were prepared from brains of 3-day-old SJL mouse pups as described in Ref. 22 (link). The cDNA and siRNA transfections were accomplished using Lipofectamine LTX with Plus reagent and the Lipofectamine siRNA Max kit, respectively (Invitrogen). Alternatively, the cDNAs/siRNAs were transfected using the Nucleofector device (Lonza) with the “transfection efficiency” program. All ofthe procedures were performed according to the manufacturer's instructions.

Belogurov A J.r., Kudriaeva A., Kuzina E., Smirnov I., Bobik T., Ponomarenko N., Kravtsova-Ivantsiv Y., Ciechanover A, & Gabibov A. (2014). Multiple Sclerosis Autoantigen Myelin Basic Protein Escapes Control by Ubiquitination during Proteasomal Degradation. The Journal of Biological Chemistry, 289(25), 17758-17766.

+ Open protocol

+ Expand

CRISPR Transfection of U2OS Cells

Cited 2 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

Transient transfections of U2OS-Cas9-NBS1-GFP cells were carried out using Lipofectamine LTX with plus reagent (Invitrogen) according to the manufacturer's specifications and collected 0–6 h post-transfection unless otherwise stated. The four gRNA plasmids used for transfection were ampicillin resistant pMA plasmids (generated by the Luo laboratory) expressing either rDNA targeting sequences (Supplementary Table S1) (22 (link)) or a control pMA vector expressing the gRNA scaffold but no target sequence. The cloning of CRISPR gRNAs was carried out as described previously (27 (link)). Unless otherwise stated the three rDNA gRNA plasmids were pooled in a ratio 1:1:1 for each transfection. The TCOF1 wild-type (wt) construct was previously described (28 (link)).

Korsholm L.M., Gál Z., Lin L., Quevedo O., Ahmad D.A., Dulina E., Luo Y., Bartek J, & Larsen D.H. (2019). Double-strand breaks in ribosomal RNA genes activate a distinct signaling and chromatin response to facilitate nucleolar restructuring and repair. Nucleic Acids Research, 47(15), 8019-8035.

+ Open protocol

+ Expand

Generation of BRG1 Knockout Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols

BRG1 knockout cell lines were obtained at the same time that tunable SMASh-tagged BRG1 cells were generated. HCT116 cells were co-transfected in a ratio 3:1 with a recombination template (pBS BRG1 SMASh tag), and a plasmid encoding the endonuclease Cas9 and a gRNA targeting BRG1 gene (5′-caccgGGCCGAGGAGTTCCGCCCAG-3′, 5′-aaacCTGGGCGGAACTCCTCGGCCc-3′) just after the initial codon (pSpCas9n(BB)-2A-puro). Cells were transfected using Lipofectamine LTX with Plus reagent (Invitrogen) following the manufacturer’s recommendation and clones were selected in the presence of 800 mg/mL Geneticin (G418 Sulfate, Gibco) in the growing medium. Clonal cell populations were screened by Western blotting and BRG1 deletion was confirmed by sequencing and in clone 2 by proteomic analysis.

Schiavoni F., Zuazua-Villar P., Roumeliotis T.I., Benstead-Hume G., Pardo M., Pearl F.M., Choudhary J.S, & Downs J.A. (2022). Aneuploidy tolerance caused by BRG1 loss allows chromosome gains and recovery of fitness. Nature Communications, 13, 1731.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!