RNA was extracted and purified using Qiagen RNeasy mini kit as described by manufacturer (Qiagen). Amplification was conducted with a Rotor Gene Q real time PCR cycler (Qiagen) using Rotor-Gene SYBR® Green PCR kit (Qiagen) in four biological and two technical replicas using the following parameters: 95°C/10 min (one cycle), 95°C/10 s, and 60°C/45 s (40 cycles). cDNA for qPCRs was made with random hexamers from the same RNA samples that were used for RNA-sequencing. 16S rRNA gene of P. s. pv. syringae B728a (NC_007005) was used as a reference in all qPCR experiments. The specificity of all amplifications was confirmed by single-peak melting curves. Delta Delta C (T) method ( ) was used for analysis of relative expression. To obtain a final ratio for any given gene, an average and a standard deviation (SD) for all biological replicates were calculated.
Rotor gene q real time pcr cycler
Manufactured by Qiagen
Sourced in Germany, United States, United Kingdom, Italy
The Rotor-Gene Q is a real-time PCR cycler designed for sensitive and accurate nucleic acid amplification and detection. It features a unique rotor-disc format that allows for simultaneous processing of up to 72 samples. The system is equipped with up to six excitation and detection channels, enabling multiplexed analysis of various targets.
Automatically generated - may contain errors
Lab products found in correlation
Rotor gene sybr green pcr kit, by Qiagen (18 mentions)
Trizol reagent, by Thermo Fisher Scientific (17 mentions)
Rneasy mini kit, by Qiagen (12 mentions)
Quantitect reverse transcription kit, by Qiagen (9 mentions)
Trizol, by Thermo Fisher Scientific (8 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (5 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (5 mentions)
Rotor gene q software, by Qiagen (4 mentions)
M mlv reverse transcriptase, by Promega (4 mentions)
M mlv reverse transcriptase, by Thermo Fisher Scientific (4 mentions)
Sybr green reagent, by Qiagen (4 mentions)
Quantinova sybr green pcr master mix, by Qiagen (4 mentions)
Miscript sybr green pcr kit, by Qiagen (3 mentions)
Iscript cdna synthesis kit, by Bio-Rad (3 mentions)
Realq plus 2x master mix green, by Ampliqon (3 mentions)
Rotor gene q series software, by Qiagen (3 mentions)
Kingfisher flex purification system, by Thermo Fisher Scientific (2 mentions)
Mulv reverse transcriptase, by Thermo Fisher Scientific (2 mentions)
Sybr green pcr master mix kit, by Thermo Fisher Scientific (2 mentions)
Miscript primer assay, by Qiagen (2 mentions)
135 protocols using rotor gene q real time pcr cycler
1
Real-time qPCR for gene expression
2
Validating miRNA Expression with Q-RT PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expression analysis of specific miRNAs was validated by quantitative real-time (Q-RT) PCR. cDNA was obtained from 0.5 μg of total RNA using the miScript II reverse transcription kit (Qiagen). Q-RT PCR was performed with QuantiFast SYBR Green PCR Master Mix (Qiagen), using a Rotor Gene Q real-time PCR cycler (Qiagen). Relative expression levels were calculated with the comparative threshold cycle (Cq) method [20 (link)], using snRNA U1 as reference for normalization.
3
SARS-CoV-2 RNA Detection Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Upon reception of the samples, RNA extraction was performed either manually using different spin column viral RNA extraction kits, or automatically using the KingFisher™ Flex Purification System (Thermo Scientific™, Thermo Fisher Scientific, Waltham, MA, USA) with different magnetic beads viral RNA extraction kits (Table S1 ) according to the manufacturers’ instructions. One-Step Reverse Transcription Real-Time polymerase chain reaction (RT-PCR) was used to confirm the presence of the SARS-CoV-2 RNA in the samples, by amplifying different genes specific for SARS-CoV-2. Different COVID-19 diagnostic kits were used (Table S2 ). RT-PCR assays were performed through two thermocycler devices: QuantStudio ™ 5 Real-Time PCR System for Human Identification (Applied BiosystemsTM, Thermo Fisher Scientific, Waltham, MA, USA) and the Rotor-Gene Q Real-Time PCR Cycler (Qiagen, Düsseldorf, Germany). The reaction mix contained COVID-19 Reaction Mixture, COVID-19 Probe Mixture, and the RNA sample. Briefly, the following steps were followed in the RT-PCR assays: reverse transcription, 40–45 cycles of denaturation, annealing, extending, and collecting fluorescence signal on different channels. The results were analyzed according to the manufacturers’ instructions.
4
Quantifying Vascular Adhesion Molecule Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The qRT-PCR assay was performed to determine the expression levels of ICAM-1 and VCAM-1 mRNA. Total RNA of the aorta was extracted using Trizol reagent (Invitrogen, CA, USA) in accordance with the manufacturer’s protocol. The concentration of RNA was detected by NanoDrop 1100 (NanoDrop Tech., DE, USA). The following primers synthesized by TaKaRa(Dalian, China) were used: GAPDH: forward primer: 5’- CTCATGACCACAGTCCATGC-3’, reverse primer: 5’- CACATTGGGGGTAGGAACAC-3’; VCAM-1: forward primer: ATTTTCTGGGGCAGGAAGTT, reverse primer: ACGTCAGAACAACCGAATCC; ICAM-1 forward 5’- TGCCTCTGAAGCTCGGATATAC-3’, reverse 5’- TCTGTCGAACTCCTCAGTCAC-3’. The cDNAs were synthesized using MuLV Reverse Transcriptase (Applied Biosystems, CA, USA). The qRT-PCR was performed with a Rotor-Gene Q real-time PCR cycler (Qiagen, Germany) using a SYBR-green PCR master mix kit (Applied Biosystems, CA, USA). Blank controls (omission of template or RNA) were designed to make sure of the absence of contamination. Data were analyzed using Rotor-gene Q v1.7 (Qiagen, Germany), and relative mRNA levels were quantified by the 2−ΔΔCt method and normalized by GAPDH mRNA. Each experiment was repeated five times.
5
Quantitative Analysis of MMP-1 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted using RNeasy Mini Kits (QIAGEN, Venlo, Netherlands) according to the manufacturer’s protocol. RT-qPCR was performed by use of SYBR® Green dye (iScriptTM One-Step RT-PCR Kit, Bio-Rad, California, United States) on Rotor-Gene Q real-time PCR cycler (QIAGEN, Venlo, Netherlands). β-actin gene was used as a control gene. The forward and reverse primers used for amplification of Matrix metalloproteinase 1 (MMP-1) and β-actin are listed in Table 4 .
The forward and reverse primers used for amplification of Matrix metalloproteinase 1 (MMP-1) and β-actin.
| Primer | The sequence of nucleotides (nt) | Size (nt) | |
|---|---|---|---|
| MMP-1 | Forward | 5′ CTA TTC TGT CAG CAC TTT GG 3′ | 20 |
| Reverse | 5′ CAG ACT TTG GTT CTC CAA CTT 3′ | 21 | |
| β-actin | Forward | 5′ GAC CTT CAA CAC CCC AGC CA 3′ | 20 |
| Reverse | 5′ GTC ACG CAC GAT TTC CCT CTC 3′ | 21 |
6
Confirming Transcriptome with qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative real-time PCR (qPCR) was performed with arbitrarily selected genes to confirm transcriptomic data. Primers were designed using the online Realtime PCR tool (Integrated DNA Technologies Inc., San Diego, USA; https://www.idtdna.com/scitools/Applications/RealTimePCR/ ) and alfalfa sequences generated in this work. cDNA for qPCR analyses was made using the SuperScript™ III First-Strand Synthesis System with oligo d(T) (ThermoFisher Scientific) and the same RNA samples that were used for RNA sequencing. Amplification was conducted with a Rotor Gene Q real time PCR cycler (Qiagen) using the Rotor-Gene SYBR® Green PCR kit (Qiagen) with three biological replicates using the following parameters: 95°C for 10 min (one cycle), 95°C for 10 s and 60°C for 45 s (40 cycles). The Delta Delta C(T) method (2−ΔΔC T) was used for analysis of relative expression [52 (link)]. To obtain a final ratio for any given gene, an average and a standard deviation for all biological replicates was calculated. The reference gene in all qPCR experiments was NP_001237047, a gene of unknown function with little variation in expression levels [53 (link)].
7
Quantitative Analysis of Gene Expression and Mitochondrial DNA Copy Number in Worms
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated using Trizol (Invitrogen, Carlsbad, CA, USA), and cDNA was synthesized using a cDNA synthesis kit (TaKaRa Bio, Dalian, China). Quantitative RT-PCR was carried out using SYBR Premix Ex Taq (TaKaRa Bio, Kyoto, Japan) and the Rotor Gene Q real-time PCR cycler (Qiagen, Hilden, Germany). Expression of the ama-1 and act-1 genes was used as endogenous control to normalize the amount of mRNA obtained from a target gene. Samples were run in triplicate, and primers are listed in Table S1 .
Quantification of the mtDNA copy number in worms was performed by real-time PCR as previously described. Briefly, relative values for nd-1 and act-3 (or 18S) were compared within each sample to generate a ratio representing the relative level of mtDNA per nuclear genome. The results obtained were confirmed with a second mitochondrial gene MTCE.26. The average of at least three technical repeats was used for each biological data point. Primer sequences are listed inTable S1 .
Quantification of the mtDNA copy number in worms was performed by real-time PCR as previously described. Briefly, relative values for nd-1 and act-3 (or 18S) were compared within each sample to generate a ratio representing the relative level of mtDNA per nuclear genome. The results obtained were confirmed with a second mitochondrial gene MTCE.26. The average of at least three technical repeats was used for each biological data point. Primer sequences are listed in
8
Quantitative gene expression analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Toal RNA from the treated cells were isolated using Trizol reagent (Invitrogen), and synthesized to cDNA using MuLV Reverse Transcriptase. Real-time PCR were performed on a Rotor-Gene Q real-time PCR cycler (Qiagen, Shanghai, China) using SYBR-green PCR master mix kits as described previously [17 (link), 19 (link)]. The primers were synthesized by Sangon Biotech (Shanghai, China) and the oligonucleotide sequences were as follows: CHOP: 5’-CCACCACACCTGAAAGCAGAA-3’(forward primer), 5’-GGTGCCCCCAATTTCATCT-3’(reverse primer); GRP78: 5’-ACATGGACCTG TTCCGCTCTA-3’ (forward primer), 5’-TGGCTCCTTGCCATTGAAGA-3’ (reverse primer); β-actin: ’-CGGGGACCTGACTGACTACC-3’ (forward primer), 5’-AGGA AGGCTGGAAGAGTGC-3’ (reverse primer). The data were analyzed using the Rotor- Gene Q software (version 1.7, Qiagen), and then relative mRNA levels were calculated by the 2–△△Ct method.
9
Quantification of hERG Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from blood and tissues using TRIzol® reagent (cat. no. 15596026; Invitrogen; Thermo Fisher Scientific, Inc.). Total RNA was reverse transcribed into cDNA using a RevertAid First Strand cDNA Synthesis Kit (cat. no. K1621; Thermo Fisher Scientific, Inc.). Reverse transcription was performed at 25°C for 5 min, followed by incubation for 60 min at 42°C. Custom primer was designed to amplify specific regions in the hERG gene and the sequences used were: Forward, 5′-CACCTCCTCGTTGGCATTG-3′ and reverse, 5′-GCTGGCTGTGGTGGACCT-3′. For reverse transcription, in addition to patient's samples, RT-negative, positive control (GAPDH) and no template negative control were setup. qPCR was subsequently performed using a SsoAdvanced Universal SYBR Green Supermix (Bio-Rad Laboratories, Inc.) on a Rotor-Gene® Q Real-Time PCR cycler (Qiagen GmbH). GAPDH served as a reference gene (forward primer, 5′-GAAGGTGAAGGTCGGAGTC-3′ and reverse primer, 5′-GAAGATGGTGATGGGATTTC-3′). The relative expression levels were analyzed using the 2−ΔΔCq method (24 (link)). The qPCR cycling conditions were as follows: 2 min at 95°C, followed by 40 cycles of denaturation at 95°C for 5 sec, annealing at 60°C for 30 sec and extension at 72°C for 45 sec, and final extension at 72°C for 5 min.
10
Quantification of Cardiovascular miRNAs by RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
MiRNA quantification was performed using reverse transcription real-time polymerase chain reaction (RT-qPCR). Briefly, cDNA was transcribed from the extracted RNA and then aliquoted into the Human Cardiovascular Disease miScript miRNA PCR Array (Qiagen, Hilden, Germany). This array contains primers for 84 miRNA sequences, an individual miRNA primer sequence per well, identified as exhibiting altered expression during cardiovascular disease. The selected miRNAs are listed in Fig. 3 . All cDNA steps and PCR setup were performed by the QIAgility instrument (Qiagen, Hilden, Germany) using an automated pipetting protocol. RT-qPCR was performed on the miRNA PCR array in the Rotor-Disc 100 format by the Rotor-Gene Q real-time PCR cycler (Qiagen, Hilden, Germany). Rotor-Gene PCR cycling was performed according to the manufacturer’s suggested protocol and conditions. Cycle threshold (Ct) represents the cycle number at which there is an exponential increase in miRNA fluorescence. Individual miRNAs were determined to be detected when Ct values were lower than 33, while miRNAs with a Ct value ≥ 33 were considered not detected. Only miRNAs detected in at least 50% of subjects were retained for analysis, resulting in 53 total miRNAs analyzed.![]()
The 84 miRNA sequences on the Human Cardiovascular Disease miScript miRNA PCR Array grouped by their functional domains.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!