The frozen sections of atrial tissue were fixed with 4% paraformaldehyde for 15 minutes, washed with 1×PBS for three times, and permeabilized in 1% TritonX-100 for 10 minutes. After washing, the sections were blocked with goat serum (Bioss, Beijing, China) for 1 hour and incubated with primary antibody, rabbit anti-CD163 (Bioss, cat#bs-2527R, RRID: AB_10856166) and mouse anti-CD86 (Santa Cruz Biotechnology, cat#sc-28347, RRID: AB_627200) at 4°C overnight. Following that, they were incubated with FITC Goat Anti-Rabbit IgG (H+L) antibody(ABclonal, cat#AS011, RRID: AB_2769476), and TRITC Goat Anti-Mouse IgG (H+L) antibody (ABclonal, cat#AS026, RRID: AB_2772721). Finally, 4′6-diamino-2-phenylindole (DAPI, Beyotime, China) was added to stain the nuclei. The sections were sealed with anti-fluorescence quencher. Imaging was performed by immunofluorescence microscope (Zeiss, Jena, Germany) and fluorescence intensity was analyzed with ImageJ.
4 6 diamino 2 phenylindole dapi
Manufactured by Beyotime
Sourced in China
4'6-diamino-2-phenylindole (DAPI) is a fluorescent dye used in various laboratory applications. It binds to the minor groove of DNA and exhibits enhanced fluorescence upon binding, making it a useful tool for DNA detection and visualization.
Automatically generated - may contain errors
Lab products found in correlation
Lsm 710, by Zeiss (4 mentions)
Fluorescence microscope, by Olympus (3 mentions)
Confocal laser scanning microscope, by Olympus (3 mentions)
Lyso tracker red, by Beyotime (2 mentions)
Anti α sma, by Cell Signaling Technology (2 mentions)
Penicillin, by Thermo Fisher Scientific (2 mentions)
Streptomycin, by Thermo Fisher Scientific (2 mentions)
Trypsin, by Thermo Fisher Scientific (2 mentions)
Goat serum, by Bioss Antibodies (1 mentions)
Immunofluorescence microscope, by Zeiss (1 mentions)
Mouse anti cd86, by Santa Cruz Biotechnology (1 mentions)
Rabbit anti cd163, by Bioss Antibodies (1 mentions)
Dulbecco s modified eagle s medium dmem, by Thermo Fisher Scientific (1 mentions)
Fetal bovine serum (fbs), by Thermo Fisher Scientific (1 mentions)
Mcf 7, by National Collection of Authenticated Cell Cultures (1 mentions)
96 well cell culture plate, by Corning (1 mentions)
Cryotube, by Corning (1 mentions)
Fluorescence microscope, by Nikon (1 mentions)
Tunel assay, by Beyotime (1 mentions)
Anti lamp1, by Abcam (1 mentions)
36 protocols using 4 6 diamino 2 phenylindole dapi
1
Immunofluorescent Staining of Atrial Tissue
2
Casticin Extraction and Cell Culture Protocols
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The whey protein isolate (WPI) was gifted from Hilmar, USA. The casticin was extracted from Vitex, and the purity was 94.6% after comparison with a standard by HPLC. The casticin standard (≥98%, V117963), L-lactose, and dimethyl sulfoxide (biochemical grade, ≥99.7%) were purchased from Aladdin Reagent Co., Ltd. (Shanghai, China). The MCF-7 and HepG2 cell lines were obtained from the China Center for Type Culture Collection (CTCC, Wuhan, Hubei, China). Fetal bovine serum (FBS) and Dulbecco’s modified eagle’s medium (DMEM) for cell culture were purchased from Gibco (Grand Island, NE, USA). Penicillin-streptomycin and 0.25% trypsin were obtained from Jinuo Biomedical Technology Co., Ltd. (Hangzhou, China). Phosphate buffer saline (PBS) was purchased from Hyclone (Logan City, UT, USA). Cell-culture flasks with a capacity of 25 cm2, 96-well cell-culture plates, and cryotubes were purchased from Corning Co., Ltd. (Shanghai, China). Nile red and coumarin-6 were purchased from Aladdin Reagent Co., Ltd. (Shanghai, China). Lyso-Tracker red (a lysosomal red fluorescent probe) and 4,6-diamino-2-phenyl indole (DAPI) were purchased from Beyotime Biotechnology Co., Ltd. (Shanghai, China) and Solarbio Technology Co., Ltd. (Beijing, China), respectively.
3
Multiplex Immunofluorescence Cell Staining
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Cell fluorescence was detected with a double-label multiplex immunofluorescence kit (AiFang Biological, Hunan, China, #AFIHC023). The cells were stained with TYR-520 or TYR-570 fluorescent dye for 15 min and washed three times with PBS according to the manufacturer’s instructions. 4′,6-diamino-2-phenylindole (DAPI, Beyotime, China) was utilized for the nucleus staining. Cells were detected utilizing a fluorescence microscope (Nikon, Tokyo, Japan).
4
Linc-pint RNA in situ Hybridization
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Formalin-fixed paraffin-embedded sections (4μm) were baked at 45°C overnight. RNA in situ hybridization was performed using a Linc-pint probe (cctgggatgaatcgggaggagcggtggagactccggagacaggtgccgcgctggtctgggctgccggctaaaagttgtcctccgcgcggtgggcggtggggtccccggccagggccaaggaccccggctccctgccccccggcgtcgcccacttgtcacgccaggctgctgcgtgcactcggctgcaggggaggtggcgtagtttctcttcctcccacctcttctcactcacttgtttttgtagccgtgg). Tissues were deparaffinized by immersing in fresh xylene twice and then digested in proteinase K. Slides were immersed in wash buffer and treated with pre-cooled ethanol. Slides were then incubated with FITC-labelled target probes overnight, and counterstained with 4′6-diamino-2-phenylindole (DAPI, Beyotime, Nanjing, China). Finally, the slides were viewed using a laser scanning confocal microscope (40×, Olympus, Japan).
5
Apoptosis Detected by TUNEL Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Apoptosis was detected by using TUNEL assay (Beyotime Biotechnology, Shanghai, China). The nuclei were stained again with 4,6-diamino-2-phenylindole (DAPI; Beyotime Biotechnology, Shanghai, China). Three random regions of each group of cells were observed under a fluorescence microscope (Leica, DE).
6
Immunofluorescence Analysis of UBL4A in Tumor Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The tumor cells transfected with Lv-UBL4A-Flag and Lv-shUBL4A as well as their controls were seeded on 24-well plates. The cells were fixed with 4% paraformaldehyde for 30 min and were permeabilized with 0.5% Triton X-100 for 20 min. After incubation for 2 h with anti-UBL4A (Proteintech, Wuhan, Hubei, China), anti-LAMP1 (Abcam, Shanghai, China) and anti-LC3B (Cell Signaling Technology, Danvers, MA, USA), the cells were washed with PBS three times. Then, the cells were incubated with secondary antibodies for 1 h (Bioss, Beijing, China), and 4′6-diamino-2-phenylindole (DAPI, Beyotime Biotechnology, Shanghai, China) was added to stain the cell nuclei. Finally, the cells were viewed with a fluorescence microscope (20×, Olympus). Information on the primary antibodies for immunofluorescence is provided in Additional file 3 : Table S3.
7
Baicalein-Loaded Liposomes for Enhanced Cellular Uptake
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Baicalein (98% purity) was purchased from Nanjing Zelang Biological Technology Co. Ltd. Soybean phospholipids were purchased from Shanghai Tywei Pharmaceutical Co. Ltd. Ethylis oleas was purchased from Jiangxi Alpha High‐Tech Pharmaceutical Co., Ltd. Tween 80 was cgqzlied by Shanghai Macklin Biochemical Co., Ltd. Transcutol HP was kindly donated by Gattefossé. Ascorbic acid and tetrahydrofuran were cgqzlied by Sinopharm Chemical Reagent Co., Ltd. Minimum Essential Medium (MEM), fetal bovine serum, non‐essential amino‐acid, L‐glutamine, penicillin, streptomycin, and 0.25% trypsin were purchased from Thermo Fisher Scientific. Coumarin 6 (Cou‐6), methyl‐β‐cyclodextrin, chlorpromazine hydrochloride, genistein, and amiloride hydrochloride were purchased from Sigma‐Aldrich. Brefeldin A, monensin, nocodazole, and 4,6‐diamino‐2‐phenyl indole (DAPI) were purchased from Beyotime Biotechnology Co., Ltd. Bafilomycin A1 was cgqzlied by Meilunbio. 1,1′‐Dioctadecyl‐3,3,3′,3′‐tetramethylindotricarbocyanine iodide (DiR) was obtained from AAT Bioquest Inc. Tetramethylrhodaminyl (TRITC) phalloidin was purchased from Yeasen Biotechnology Co., Ltd.
8
Immunofluorescence Characterization of Cardiomyocytes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Atrial cardiomyocytes isolated from atria were fixed with 4% paraformaldehyde for 30 min and permeabilized with 0.5% Triton X-100 for 15 min. After incubation for 2 h at room temperature with anti-LC3B (CST, 1:100) and anti-Cav1.2 (Abcam, 1:200), cells were washed with 1% PBS. Then they were incubated with secondary antibodies (Beyotime, China, 1:200) for 1 h. Finally, 4′6-diamino-2- phenylindole (DAPI, Beyotime, China) was added to stain the nuclei. Tissues and cells were detected by laser scanning confocal microscope (100×, ZEISS 510S, Germany).
9
Spinal Cord Protein Expression Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
On the 21st day after surgery, immunofluorescence was performed to detect protein expression levels in spinal cord tissue. Tissue slices were generated as described in the Histological analysis subsection. In brief, after dewaxing and rehydrating the slices, antigen retrieval was performed by boiling 10-micrometer spinal cord slices in 10 mM sodium citrate buffer (pH 9.0, 80°C) for 0.5 hours. Each slice was blocked in 5% bovine serum albumin for 60 minutes at 37°C, then stained with Alexa Fluor® 488 anti-microtubule-associated protein light chain 3 (LC3) rabbit monoclonal antibody (1:50, CST, Danvers, MA, USA, Cat# 13082, RRID: AB_2687880), anti-SQSTM1/p62 rabbit polyclonal antibody (1:100, Affinity, Cincinnati, OH, USA Cat# AF5384, RRID: AB_2837869), and Alexa Fluor® 647 rabbit monoclonal anti-NeuN antibody (1:50, Abcam, Cambridge, UK, Cat# ab190565, RRID: AB_2732785) overnight at 4°C. 4,6-Diamino-2-phenylindole (DAPI; Beyotime, C1005) was used to stain the nuclei (37°C, 10 minutes, dark room). Stained slices from six rats each group were observed under a fluorescence microscope (Eclipse C1, Nikon), and Image Pro Plus 6.0 (Media Cybernetics, Rockville, MD, USA) was used to analyze the fluorescence intensity of the tissue slices.
10
Immunofluorescent Identification of Rat NP Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Immunofluorescence identification of primary rat NP cells was carried out by Procell. In brief, primary NP cells were fixed with 4% paraformaldehyde (Sinopharm, China) before permeabilization with 0.5% Triton X-100 (Beyotime, China). The cells were incubated with anti-type II collagen antibody (1:100, Cat No.: BA0533; Boster, China) at 4 °C overnight and then with Cy3-labeled secondary antibody (1:100, Cat No.: BA1032; Boster) at room temperature for 1 h. The nuclei were counterstained with 4,6-diamino-2-phenyl indole (DAPI) (Beyotime). A fluorescence microscope (BX53, Olympus, Japan) was used for image capture. The positive cells under five random high-power fields were counted under a light microscope, and the purity of NP cells was assessed by determining the type II collagen-positive cell rate.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!